Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17000
Trapped Gene
Mrpl52 (ENSMUSG00000010406)
Vector Insertion
Chr 14: 55047486 - 55048418
Public Clones CMHD-GT_363B3-3 (cmhd)
Private Clones OST451068 (lexicon) OST417351 (lexicon) OST337435 (lexicon) OST335768 (lexicon)
OST326229 (lexicon) OST316535 (lexicon) OST316511 (lexicon) OST316507 (lexicon)
OST316506 (lexicon) OST316499 (lexicon) OST255617 (lexicon) OST202513 (lexicon)
OST187482 (lexicon) OST36627 (lexicon) OST16362 (lexicon) OST7029 (lexicon)
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000124126 (Chr14:55047421..55047485 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000124126 (Chr14:55047421..55047485 +)
Downstram Exon
ENSMUSE00000124123 (Chr14:55048419..55048590 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000124124 Chr14:55045747..55045797 No primer for this exon
upstream ENSMUSE00000124125 Chr14:55045871..55045928 No primer for this exon
upstream ENSMUSE00000124127 Chr14:55046008..55046075 No primer for this exon
upstream ENSMUSE00000124126 Chr14:55047421..55047485 No primer for this exon

*** Putative Vector Insertion (Chr 14: 55047486 - 55048418) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000124123 Chr14:55048419..55048590 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGGAGAAGCTTGCAGTGA Chr14:55047471..55047491 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGGAGAAGCTTGCAGTGA Chr14:55047471..55047491 60.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010406