Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17014
Trapped Gene
Magix (ENSMUSG00000031147)
Vector Insertion
Chr X: 7257173 - 7258075
Public Clones not available
Private Clones OST450885 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000206874 (ChrX:7258076..7258215 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCTGCGCTAAAAACTAATC ChrX:7258163..7258183 60.1 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000206874 (ChrX:7258076..7258215 -)
Downstram Exon
ENSMUSE00000206873 (ChrX:7257026..7257172 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCTGCGCTAAAAACTAATC ChrX:7258163..7258183 60.1 47.62 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703884 ChrX:7258272..7258350 GACTTTACAGCTCCCGCAAC ChrX:7258295..7258314 59.88 55
upstream ENSMUSE00000206874 ChrX:7258076..7258215 CCCCTGCGCTAAAAACTAATC ChrX:7258163..7258183 60.1 47.62

*** Putative Vector Insertion (Chr X: 7257173 - 7258075) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000206873 ChrX:7257026..7257172 No primer for this exon
downstream ENSMUSE00000206872 ChrX:7254246..7254328 GTAGCATGAGGCAAGCGACT ChrX:7254246..7254265 60.57 55
downstream ENSMUSE00000206876 ChrX:7253226..7253462 CATTTCGGCCTCCACTTAAA ChrX:7253278..7253297 60.07 45
downstream ENSMUSE00000206875 ChrX:7252967..7253135 CCAGTTCGAATCCTCTCCAC ChrX:7253031..7253050 59.65 55
downstream ENSMUSE00000394744 ChrX:7251754..7252317 GGGTACCAGGGATACGGTTT ChrX:7252116..7252135 59.94 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000031147