Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17018
Trapped Gene
Gse1 (ENSMUSG00000031822)
Vector Insertion
Chr 8: 123061463 - 123077483
Public Clones (sanger) (sanger) (sanger) (sanger) P151B10 (ggtc) 3SE171E11 (ggtc)
IST13016G6 (tigm) IST14697E6 (tigm)
Private Clones OST450788 (lexicon) OST403467 (lexicon) OST371639 (lexicon) OST290774 (lexicon)
OST283572 (lexicon) OST238945 (lexicon) OST135505 (lexicon) OST99295 (lexicon)
OST43680 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720605 (Chr8:123061329..123061462 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGGTGAGATAAGCAGTTCAG Chr8:123061373..123061393 59.88 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720605 (Chr8:123061329..123061462 +)
Downstram Exon
ENSMUSE00000579735 (Chr8:123077484..123077702 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGGTGAGATAAGCAGTTCAG Chr8:123061373..123061393 59.88 52.38 CATCCCTATGGAAGGGGACT Chr8:123077524..123077543 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000605789 Chr8:123012766..123013051 CTTGGACGCTGGTTTTGTTT Chr8:123012910..123012929 60.15 45
upstream ENSMUSE00000710445 Chr8:123059757..123059854 AACTAACGCGTGGACCAAAG Chr8:123059792..123059811 60.17 50
upstream ENSMUSE00000720605 Chr8:123061329..123061462 CGGGTGAGATAAGCAGTTCAG Chr8:123061373..123061393 59.88 52.38

*** Putative Vector Insertion (Chr 8: 123061463 - 123077483) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000579735 Chr8:123077484..123077702 CATCCCTATGGAAGGGGACT Chr8:123077524..123077543 60.15 55
downstream ENSMUSE00000710125 Chr8:123077484..123077702 CATCCCTATGGAAGGGGACT Chr8:123077524..123077543 60.15 55
downstream ENSMUSE00000213352 Chr8:123086526..123086725 CCAGACTCCATTGACGGTTT Chr8:123086710..123086729 59.97 50
downstream ENSMUSE00000213358 Chr8:123090268..123090440 AAGCGGGAGTCCTGTACAAC Chr8:123090431..123090450 59.21 55
downstream ENSMUSE00000303569 Chr8:123090827..123091024 GCAAGGAGGACATGCGTAAG Chr8:123090939..123090958 60.8 55
downstream ENSMUSE00000213364 Chr8:123091663..123091854 ATGGGGTAGAACGGAGACCT Chr8:123091716..123091735 59.82 55
downstream ENSMUSE00000371311 Chr8:123092061..123092383 AGGAAGGTGGTGGGCTCTAA Chr8:123092300..123092319 61.01 55
downstream ENSMUSE00000303504 Chr8:123092952..123093276 AGCCACTTCTCCTCCTCGTT Chr8:123093135..123093154 60.39 55
downstream ENSMUSE00000303484 Chr8:123094617..123095239 CTGAGGCTCCAGACTTCCTG Chr8:123094977..123094996 60.13 60
downstream ENSMUSE00000213370 Chr8:123096204..123096316 TCTCGTCGTACGAGTCATCG Chr8:123096242..123096261 60.01 55
downstream ENSMUSE00000213351 Chr8:123096536..123096806 TTCCTCTTCTCCGCACTGAT Chr8:123096807..123096826 59.95 50
downstream ENSMUSE00000213366 Chr8:123098071..123098178 GGACAGTGCTCTCTGCTTCA Chr8:123098126..123098145 59.29 55
downstream ENSMUSE00000213350 Chr8:123098834..123099205 CGTGGAATTGATGTGCAAAC Chr8:123099163..123099182 59.97 45
downstream ENSMUSE00000213354 Chr8:123100176..123100454 CTCGCTGTCCTCCTCAGAGT Chr8:123100378..123100397 59.73 60
downstream ENSMUSE00000213357 Chr8:123101871..123101974 GGCTGAGGCTGTAGTTCTGC Chr8:123101945..123101964 60.16 60
downstream ENSMUSE00000351895 Chr8:123102369..123105276 AAGGGGGCTACTGTGGTCTT Chr8:123104382..123104401 59.99 55
downstream ENSMUSE00000712712 Chr8:123102369..123103226 AGAGGAAATAACGCCGACCT Chr8:123102740..123102759 60.1 50
downstream ENSMUSE00000715807 Chr8:123102369..123103380 AACCCCCAAACAGGAAAAAC Chr8:123103316..123103335 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTTGTGGTCAGACATTGG Chr8:123064472..123064492 60.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCTCGTGACTGGGAAAA Chr8:123064508..123064528 60.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031822