Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17020
Trapped Gene
2610109H07Rik (ENSMUSG00000029005)
Vector Insertion
Chr 4: 147476692 - 147482043
Public Clones (ggtc) CMHD-GT_381B12-3 (cmhd) IST10218F11HMF1 (tigm) IST10292D2 (tigm)
Private Clones OST450784 (lexicon) OST287344 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000184427 (Chr4:147482044..147482133 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000184427 (Chr4:147482044..147482133 -)
Downstram Exon
ENSMUSE00000184421 (Chr4:147472547..147476691 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TAAACCGCTCTCCAGCTTGT Chr4:147476393..147476412 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447651 Chr4:147504682..147504788 No primer for this exon
upstream ENSMUSE00000447643 Chr4:147489668..147490109 GAAACGTGGCAGAGAACACA Chr4:147489701..147489720 59.88 50
upstream ENSMUSE00000447626 Chr4:147486821..147487014 GGAGGGTACCATGGAGGAGT Chr4:147486928..147486947 60.19 60
upstream ENSMUSE00000447621 Chr4:147484154..147484265 CACACTGGACATGGCCTTATT Chr4:147484213..147484233 59.87 47.62
upstream ENSMUSE00000184423 Chr4:147483731..147483820 TGTGACCATCACCAGGATTG Chr4:147483739..147483758 60.38 50
upstream ENSMUSE00000184427 Chr4:147482044..147482133 No primer for this exon

*** Putative Vector Insertion (Chr 4: 147476692 - 147482043) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184421 Chr4:147472547..147476691 TAAACCGCTCTCCAGCTTGT Chr4:147476393..147476412 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGAATAGGCTGGACGAGT Chr4:147479033..147479053 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGGAATAGGCTGGACGAGT Chr4:147479033..147479053 60.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCCAGCATCTGGCTTCTAAT Chr4:147479134..147479154 59.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCCAGCATCTGGCTTCTAAT Chr4:147479134..147479154 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029005