Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17032
Trapped Gene
Yeats2 (ENSMUSG00000041215)
Vector Insertion
Chr 16: 20190563 - 20193231
Public Clones IST13963H4 (tigm) IST12472A6 (tigm) IST11670D7 (tigm) IST12472A6 (tigm)
IST12155D9 (tigm) IST12322E8 (tigm) IST12835E8 (tigm) IST12322E8 (tigm)
IST11670D7 (tigm) IST12835E8 (tigm)
Private Clones OST450594 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000645049 (Chr16:20190459..20190562 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTACAAGCAAGCTCCCAGT Chr16:20190464..20190483 59.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000645049 (Chr16:20190459..20190562 +)
Downstram Exon
ENSMUSE00000645048 (Chr16:20193232..20193339 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTACAAGCAAGCTCCCAGT Chr16:20190464..20190483 59.5 55 GGCTCTGCACTTTAGGGTGA Chr16:20193304..20193323 60.4 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000620887 Chr16:20141181..20141308 GGAGGAGACCTTTCGCTCTT Chr16:20141227..20141246 59.96 55
upstream ENSMUSE00000268659 Chr16:20150534..20150633 TGGAATCAAGCGAACAATCA Chr16:20150539..20150558 60.2 40
upstream ENSMUSE00000268650 Chr16:20152982..20153079 GCAGCTGTGCAGAAAATTGA Chr16:20152990..20153009 60.14 45
upstream ENSMUSE00000561643 Chr16:20152982..20153079 GCAGCTGTGCAGAAAATTGA Chr16:20152990..20153009 60.14 45
upstream ENSMUSE00000268743 Chr16:20154210..20154302 GGCCTGCATTGTAGCAAACT Chr16:20154248..20154267 60.28 50
upstream ENSMUSE00000268731 Chr16:20156960..20157205 TCCGATGGCTTTTAATCACC Chr16:20156977..20156996 59.9 45
upstream ENSMUSE00000268724 Chr16:20159210..20159325 CAAACGGGAACTACGGAATG Chr16:20159236..20159255 60.36 50
upstream ENSMUSE00000268716 Chr16:20162049..20162210 TCCAGATAAGCGGGAAGAAA Chr16:20162058..20162077 59.78 45
upstream ENSMUSE00000268644 Chr16:20171264..20171375 AGCCAGAACAAGCGGATAGA Chr16:20171337..20171356 59.98 50
upstream ENSMUSE00000268638 Chr16:20174568..20174612 CTACAGACCCTGGGTGCAGA Chr16:20174589..20174608 61.27 60
upstream ENSMUSE00000268632 Chr16:20179574..20179748 GCACTCGCTTGGTGAAGACT Chr16:20179597..20179616 60.6 55
upstream ENSMUSE00000268624 Chr16:20186324..20186563 CTATCGCATCAAGCTGCAAA Chr16:20186459..20186478 60.12 45
upstream ENSMUSE00000268619 Chr16:20189412..20189570 CATCACCATTACCTCGCACA Chr16:20189436..20189455 60.54 50
upstream ENSMUSE00000645049 Chr16:20190459..20190562 CCTACAAGCAAGCTCCCAGT Chr16:20190464..20190483 59.5 55

*** Putative Vector Insertion (Chr 16: 20190563 - 20193231) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645048 Chr16:20193232..20193339 GGCTCTGCACTTTAGGGTGA Chr16:20193304..20193323 60.4 55
downstream ENSMUSE00000645047 Chr16:20193717..20193899 GGGTGCAATCTTTGGTGACT Chr16:20193896..20193915 59.97 50
downstream ENSMUSE00000645046 Chr16:20203728..20203986 CTCCACCTCCACTCACGATT Chr16:20203902..20203921 60.11 55
downstream ENSMUSE00000645045 Chr16:20206157..20206318 GTAGTTGCAAGGTGGCCATT Chr16:20206180..20206199 60 50
downstream ENSMUSE00000645044 Chr16:20207697..20207866 GGGGTTTGCTTGAGGATGTA Chr16:20207865..20207884 59.93 50
downstream ENSMUSE00000645043 Chr16:20208492..20208650 CTTGAACCACCGATGCAGTA Chr16:20208567..20208586 59.72 50
downstream ENSMUSE00000645042 Chr16:20210105..20210281 CATTTGCTGAGAAGGCCACT Chr16:20210270..20210289 60.4 50
downstream ENSMUSE00000645041 Chr16:20211642..20211822 GATGACACAGGGGTTGATCC Chr16:20211670..20211689 60.18 55
downstream ENSMUSE00000645039 Chr16:20213340..20213468 CAGGCATCAAGACAGTCTGC Chr16:20213462..20213481 59.58 55
downstream ENSMUSE00000645036 Chr16:20214464..20214565 GGAACACTTATGGGCAGGAC Chr16:20214524..20214543 59.41 55
downstream ENSMUSE00000645034 Chr16:20218457..20218559 AGTTTGGCCCAGGAGTTTCT Chr16:20218492..20218511 60.11 50
downstream ENSMUSE00000645033 Chr16:20219691..20219764 CTGCTGGATGGTCTCCAAAT Chr16:20219721..20219740 60.07 50
downstream ENSMUSE00000645032 Chr16:20221747..20221826 GGACTTCGCAGAAAAACAGC Chr16:20221781..20221800 60 50
downstream ENSMUSE00000645031 Chr16:20222813..20223014 CTTGGTCTTGAGGGGAGTCA Chr16:20222905..20222924 60.23 55
downstream ENSMUSE00000268533 Chr16:20227786..20228012 TCCCTTTTCTGGAACTGCTG Chr16:20227864..20227883 60.37 50
downstream ENSMUSE00000471864 Chr16:20227786..20227913 TCCCTTTTCTGGAACTGCTG Chr16:20227864..20227883 60.37 50
downstream ENSMUSE00000268527 Chr16:20228770..20228844 No primer for this exon
downstream ENSMUSE00000268521 Chr16:20229571..20229644 GTTGGGAGATGCTGTCTGGT Chr16:20229645..20229664 60.12 55
downstream ENSMUSE00000492268 Chr16:20230838..20232646 CAGCTCTCAGGTACGGAAGG Chr16:20232128..20232147 60.01 60
downstream ENSMUSE00000561639 Chr16:20231941..20232347 GCACGGTAGATCCCTTGGTA Chr16:20232152..20232171 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTGCTACTAATCGCCTTG Chr16:20190605..20190625 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAGGTAAACTGTCCCTGCT Chr16:20190559..20190580 58.85 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041215