Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17043
Trapped Gene
Chd3 (ENSMUSG00000018474)
Vector Insertion
Chr 11: 69178307 - 69182410
Public Clones IST14354H7 (tigm) IST14517G3 (tigm) IST12306F8 (tigm)
Private Clones OST450450 (lexicon) OST417242 (lexicon) OST115964 (lexicon) OST102129 (lexicon)
OST77352 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000384666 (Chr11:69182411..69182496 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000384666 (Chr11:69182411..69182496 -)
Downstram Exon
ENSMUSE00000412500 (Chr11:69178194..69178306 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677516 Chr11:69182914..69182978 No primer for this exon
upstream ENSMUSE00000651787 Chr11:69182737..69182769 No primer for this exon
upstream ENSMUSE00000344075 Chr11:69182638..69182734 No primer for this exon
upstream ENSMUSE00000365785 Chr11:69182638..69182908 No primer for this exon
upstream ENSMUSE00000499278 Chr11:69182638..69182720 No primer for this exon
upstream ENSMUSE00000677544 Chr11:69182638..69182928 No primer for this exon
upstream ENSMUSE00000384666 Chr11:69182411..69182496 No primer for this exon

*** Putative Vector Insertion (Chr 11: 69178307 - 69182410) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000412500 Chr11:69178194..69178306 No primer for this exon
downstream ENSMUSE00000456182 Chr11:69177475..69177645 No primer for this exon
downstream ENSMUSE00000456176 Chr11:69177122..69177246 No primer for this exon
downstream ENSMUSE00000456173 Chr11:69175538..69175824 No primer for this exon
downstream ENSMUSE00000389889 Chr11:69175173..69175303 No primer for this exon
downstream ENSMUSE00000249426 Chr11:69174887..69175037 No primer for this exon
downstream ENSMUSE00000358555 Chr11:69174551..69174744 No primer for this exon
downstream ENSMUSE00000388236 Chr11:69174047..69174277 No primer for this exon
downstream ENSMUSE00000343303 Chr11:69173674..69173877 No primer for this exon
downstream ENSMUSE00000111876 Chr11:69173329..69173540 No primer for this exon
downstream ENSMUSE00000111875 Chr11:69172629..69172760 No primer for this exon
downstream ENSMUSE00000711544 Chr11:69171745..69171844 No primer for this exon
downstream ENSMUSE00000720468 Chr11:69171745..69171844 No primer for this exon
downstream ENSMUSE00000578790 Chr11:69171207..69171398 No primer for this exon
downstream ENSMUSE00000677541 Chr11:69171207..69171398 No primer for this exon
downstream ENSMUSE00000578789 Chr11:69170867..69171067 No primer for this exon
downstream ENSMUSE00000677540 Chr11:69170867..69171067 No primer for this exon
downstream ENSMUSE00000183593 Chr11:69170440..69170577 No primer for this exon
downstream ENSMUSE00000677539 Chr11:69170440..69170577 No primer for this exon
downstream ENSMUSE00000183641 Chr11:69170038..69170159 No primer for this exon
downstream ENSMUSE00000677538 Chr11:69170038..69170159 No primer for this exon
downstream ENSMUSE00000578788 Chr11:69169709..69169882 No primer for this exon
downstream ENSMUSE00000677537 Chr11:69169709..69169882 No primer for this exon
downstream ENSMUSE00000183632 Chr11:69169133..69169274 No primer for this exon
downstream ENSMUSE00000677536 Chr11:69169133..69169274 No primer for this exon
downstream ENSMUSE00000578787 Chr11:69168841..69168972 No primer for this exon
downstream ENSMUSE00000677535 Chr11:69168841..69168972 No primer for this exon
downstream ENSMUSE00000578786 Chr11:69167867..69167984 No primer for this exon
downstream ENSMUSE00000677534 Chr11:69167867..69167984 No primer for this exon
downstream ENSMUSE00000578785 Chr11:69167564..69167688 No primer for this exon
downstream ENSMUSE00000677533 Chr11:69167564..69167688 No primer for this exon
downstream ENSMUSE00000677532 Chr11:69167166..69167397 No primer for this exon
downstream ENSMUSE00000677543 Chr11:69167166..69167397 No primer for this exon
downstream ENSMUSE00000578784 Chr11:69167161..69167397 No primer for this exon
downstream ENSMUSE00000578783 Chr11:69166690..69166851 No primer for this exon
downstream ENSMUSE00000677531 Chr11:69166690..69166856 No primer for this exon
downstream ENSMUSE00000677542 Chr11:69166690..69166856 No primer for this exon
downstream ENSMUSE00000578782 Chr11:69166049..69166226 No primer for this exon
downstream ENSMUSE00000677530 Chr11:69166049..69166226 No primer for this exon
downstream ENSMUSE00000578781 Chr11:69165602..69165667 No primer for this exon
downstream ENSMUSE00000677529 Chr11:69165602..69165667 No primer for this exon
downstream ENSMUSE00000578780 Chr11:69164586..69164671 No primer for this exon
downstream ENSMUSE00000677528 Chr11:69164586..69164671 No primer for this exon
downstream ENSMUSE00000578779 Chr11:69164294..69164427 No primer for this exon
downstream ENSMUSE00000677527 Chr11:69164294..69164427 No primer for this exon
downstream ENSMUSE00000578778 Chr11:69163609..69163753 No primer for this exon
downstream ENSMUSE00000677526 Chr11:69163609..69163753 No primer for this exon
downstream ENSMUSE00000578772 Chr11:69163292..69163454 No primer for this exon
downstream ENSMUSE00000578777 Chr11:69163292..69163454 No primer for this exon
downstream ENSMUSE00000578776 Chr11:69162673..69162794 No primer for this exon
downstream ENSMUSE00000677525 Chr11:69162673..69162794 No primer for this exon
downstream ENSMUSE00000578775 Chr11:69162423..69162558 No primer for this exon
downstream ENSMUSE00000677524 Chr11:69162423..69162558 No primer for this exon
downstream ENSMUSE00000578774 Chr11:69162212..69162313 No primer for this exon
downstream ENSMUSE00000383315 Chr11:69161895..69162023 No primer for this exon
downstream ENSMUSE00000677523 Chr11:69161895..69162023 No primer for this exon
downstream ENSMUSE00000337079 Chr11:69161255..69161363 No primer for this exon
downstream ENSMUSE00000677522 Chr11:69161255..69161363 No primer for this exon
downstream ENSMUSE00000651798 Chr11:69160568..69160700 No primer for this exon
downstream ENSMUSE00000677521 Chr11:69160568..69160700 No primer for this exon
downstream ENSMUSE00000578773 Chr11:69160120..69160315 No primer for this exon
downstream ENSMUSE00000677520 Chr11:69160120..69160315 No primer for this exon
downstream ENSMUSE00000249211 Chr11:69158973..69159136 No primer for this exon
downstream ENSMUSE00000677519 Chr11:69158973..69159136 No primer for this exon
downstream ENSMUSE00000249203 Chr11:69158638..69158764 No primer for this exon
downstream ENSMUSE00000677518 Chr11:69158638..69158764 No primer for this exon
downstream ENSMUSE00000588657 Chr11:69156775..69157980 No primer for this exon
downstream ENSMUSE00000677517 Chr11:69156775..69157980 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCTGCCTCTACTTGGAC Chr11:69182420..69182440 60.16 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCTGCCTCTACTTGGAC Chr11:69182420..69182440 60.16 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGTGTCCTAGGGCAAGAGG Chr11:69182471..69182491 59.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGTGTCCTAGGGCAAGAGG Chr11:69182471..69182491 59.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018474