Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1705
Trapped Gene
Rapgef6 (ENSMUSG00000037533)
Vector Insertion
Chr 11: 54424289 - 54424422
Public Clones CF0672 (sanger) AY0426 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000460739 (Chr11:54424290..54424421 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACAACCCTCATCCACAGG Chr11:54424322..54424341 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000460739 (Chr11:54424290..54424421 +)
Downstram Exon
ENSMUSE00000653466 (Chr11:54424290..54424421 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACAACCCTCATCCACAGG Chr11:54424322..54424341 59.96 55 CCTGTGGATGAGGGTTGTCT Chr11:54424344..54424363 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710065 Chr11:54336349..54336620 TGCGAAGACTTGTTTGCTTG Chr11:54336424..54336443 60.17 45
upstream ENSMUSE00000717382 Chr11:54336349..54336620 TGCGAAGACTTGTTTGCTTG Chr11:54336424..54336443 60.17 45
upstream ENSMUSE00000376500 Chr11:54336392..54336620 TGCGAAGACTTGTTTGCTTG Chr11:54336424..54336443 60.17 45
upstream ENSMUSE00000351766 Chr11:54357081..54357151 CAAACCTCAGGGAGCATCAG Chr11:54357127..54357146 60.79 55
upstream ENSMUSE00000678424 Chr11:54357081..54357151 CAAACCTCAGGGAGCATCAG Chr11:54357127..54357146 60.79 55
upstream ENSMUSE00000393204 Chr11:54359875..54359931 No primer for this exon
upstream ENSMUSE00000678422 Chr11:54359875..54359931 No primer for this exon
upstream ENSMUSE00000410454 Chr11:54366292..54366375 No primer for this exon
upstream ENSMUSE00000678420 Chr11:54366292..54366375 No primer for this exon
upstream ENSMUSE00000370199 Chr11:54374827..54374896 TGGTAAGCAGTTTGGAGGAAA Chr11:54374830..54374850 59.73 42.86
upstream ENSMUSE00000678418 Chr11:54374827..54374896 TGGTAAGCAGTTTGGAGGAAA Chr11:54374830..54374850 59.73 42.86
upstream ENSMUSE00000409569 Chr11:54381855..54381998 AGGAGAACGCCAAACCATAA Chr11:54381947..54381966 59.57 45
upstream ENSMUSE00000678416 Chr11:54381855..54381998 AGGAGAACGCCAAACCATAA Chr11:54381947..54381966 59.57 45

*** Putative Vector Insertion (Chr 11: 54424289 - 54424422) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000460739 Chr11:54424290..54424421 CCTGTGGATGAGGGTTGTCT Chr11:54424344..54424363 59.96 55
downstream ENSMUSE00000653466 Chr11:54424290..54424421 CCTGTGGATGAGGGTTGTCT Chr11:54424344..54424363 59.96 55
downstream ENSMUSE00000310630 Chr11:54433388..54433565 CTCCCGAACAAGATCTCGAC Chr11:54433525..54433544 59.8 55
downstream ENSMUSE00000653464 Chr11:54433388..54433565 CTCCCGAACAAGATCTCGAC Chr11:54433525..54433544 59.8 55
downstream ENSMUSE00000310622 Chr11:54435818..54435954 ACCATGACGGAGCAGAGTTC Chr11:54435905..54435924 60.27 55
downstream ENSMUSE00000653463 Chr11:54435818..54435954 ACCATGACGGAGCAGAGTTC Chr11:54435905..54435924 60.27 55
downstream ENSMUSE00000678408 Chr11:54435868..54435954 ACCATGACGGAGCAGAGTTC Chr11:54435905..54435924 60.27 55
downstream ENSMUSE00000310614 Chr11:54439363..54439521 CATCGACTTTGGTCCTGACA Chr11:54439516..54439535 59.68 50
downstream ENSMUSE00000310607 Chr11:54440087..54440239 CTAGCTCACGGTGCTCATGT Chr11:54440204..54440223 59.06 55
downstream ENSMUSE00000310600 Chr11:54444694..54444858 CATGATGAGACGCTCAGGTG Chr11:54444720..54444739 60.43 55
downstream ENSMUSE00000310594 Chr11:54448262..54448369 GCAGGATCACCTTCAAAATCA Chr11:54448325..54448345 60.07 42.86
downstream ENSMUSE00000678427 Chr11:54448262..54448511 TGTTCTTGCTGAGGGGTAGG Chr11:54448433..54448452 60.25 55
downstream ENSMUSE00000310588 Chr11:54449514..54449717 CCTCCACTTAGCCTTTGCAG Chr11:54449576..54449595 60.01 55
downstream ENSMUSE00000310585 Chr11:54453252..54453360 TTCAAGGGCTTTAGCAAGTG Chr11:54453311..54453330 58.17 45
downstream ENSMUSE00000310582 Chr11:54456213..54456453 CCACCTGAAACGGTATTTGC Chr11:54456390..54456409 60.37 50
downstream ENSMUSE00000590804 Chr11:54462684..54462841 GGCTGCTGGATGAAAGTGTT Chr11:54462793..54462812 60.26 50
downstream ENSMUSE00000579830 Chr11:54470748..54470988 ATGCACCAGTCAAACCGAAT Chr11:54470879..54470898 60.38 45
downstream ENSMUSE00000590803 Chr11:54474305..54474688 ATCTCTGAGGCAACCCAGAA Chr11:54474580..54474599 59.8 50
downstream ENSMUSE00000590802 Chr11:54477505..54477716 AAGTGCCTCTGAGTCGTGCT Chr11:54477548..54477567 60.21 55
downstream ENSMUSE00000590801 Chr11:54482116..54482239 GGTCCATGTTGGCAGAAGTC Chr11:54482220..54482239 60.52 55
downstream ENSMUSE00000653470 Chr11:54485157..54485180 AGACTCCGCCACCTCTTCTT Chr11:54485180..54485199 60.39 55
downstream ENSMUSE00000590799 Chr11:54489697..54489917 CACCTCCCTGGACATCTAGC Chr11:54489752..54489771 59.68 60
downstream ENSMUSE00000579837 Chr11:54489715..54489917 CAGTTTCTTGGCATTCAGCA Chr11:54489802..54489821 59.99 45
downstream ENSMUSE00000579836 Chr11:54492741..54492929 ACATGGTCTTTGGCTTGTCC Chr11:54492927..54492946 59.97 50
downstream ENSMUSE00000590798 Chr11:54492741..54492929 ACATGGTCTTTGGCTTGTCC Chr11:54492927..54492946 59.97 50
downstream ENSMUSE00000579834 Chr11:54497394..54497528 TGCAGAGAGGACGCTACAGA Chr11:54497490..54497509 59.88 55
downstream ENSMUSE00000590797 Chr11:54497394..54497528 TGCAGAGAGGACGCTACAGA Chr11:54497490..54497509 59.88 55
downstream ENSMUSE00000678405 Chr11:54501046..54501606 CTCTGGCCACTGATCTTGGT Chr11:54501145..54501164 60.26 55
downstream ENSMUSE00000718300 Chr11:54501046..54501527 CTCTGGCCACTGATCTTGGT Chr11:54501145..54501164 60.26 55
downstream ENSMUSE00000720435 Chr11:54501046..54501527 CTCTGGCCACTGATCTTGGT Chr11:54501145..54501164 60.26 55
downstream ENSMUSE00000579833 Chr11:54503679..54503907 TGTGGCTGGAGTCAGACAAG Chr11:54503735..54503754 60.02 55
downstream ENSMUSE00000590796 Chr11:54503679..54503907 TGTGGCTGGAGTCAGACAAG Chr11:54503735..54503754 60.02 55
downstream ENSMUSE00000579831 Chr11:54504740..54505242 CAGCTGGTTCGTCTCTAGGC Chr11:54505067..54505086 60.16 60
downstream ENSMUSE00000590795 Chr11:54504740..54505242 CAGCTGGTTCGTCTCTAGGC Chr11:54505067..54505086 60.16 60
downstream ENSMUSE00000653469 Chr11:54507772..54508074 ATCCAATCTTCGAGGGAACC Chr11:54508011..54508030 60.27 50
downstream ENSMUSE00000350251 Chr11:54509582..54510671 CCTGACTTCCAGTGCTCTCC Chr11:54509647..54509666 59.99 60
downstream ENSMUSE00000653468 Chr11:54509582..54512785 CCTGACTTCCAGTGCTCTCC Chr11:54509647..54509666 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCCACTAATCGCCTTGCAG Chr11:54424334..54424354 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCTCACAGACAACCCTCA Chr11:54424315..54424335 59.71 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037533