Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17050
Trapped Gene
Rapgef4 (ENSMUSG00000049044)
Vector Insertion
Chr 2: 71819409 - 71869089
Public Clones IST10285D1 (tigm)
Private Clones OST450264 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000404797 (Chr2:71819272..71819408 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACGCTGCACACTCTCAGTC Chr2:71819356..71819375 60.84 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000404797 (Chr2:71819272..71819408 +)
Downstram Exon
ENSMUSE00000166192 (Chr2:71869090..71869232 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACGCTGCACACTCTCAGTC Chr2:71819356..71819375 60.84 60 AGCCGCGTGAAAATTATGTC Chr2:71869140..71869159 60.1 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000404797 Chr2:71819272..71819408 CACGCTGCACACTCTCAGTC Chr2:71819356..71819375 60.84 60

*** Putative Vector Insertion (Chr 2: 71819409 - 71869089) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000166192 Chr2:71869090..71869232 AGCCGCGTGAAAATTATGTC Chr2:71869140..71869159 60.1 45
downstream ENSMUSE00000166191 Chr2:71872088..71872176 AGCCAGGACAGCATACCAGT Chr2:71872137..71872156 59.75 55
downstream ENSMUSE00000166190 Chr2:71883159..71883305 GAAGTCCTCCTGCTCAATGC Chr2:71883293..71883312 59.96 55
downstream ENSMUSE00000690386 Chr2:71892661..71893081 GTTGCGGGAAGTTCTCAGAC Chr2:71893066..71893085 59.85 55
downstream ENSMUSE00000166189 Chr2:71975299..71975371 CATTGTTAGAGCCCGTTTCC Chr2:71975371..71975390 59.57 50
downstream ENSMUSE00000422114 Chr2:71979210..71979229 No primer for this exon
downstream ENSMUSE00000421990 Chr2:72012480..72012533 AACGTGGGGTTCAATGAGAG Chr2:72012506..72012525 59.97 50
downstream ENSMUSE00000422107 Chr2:72012859..72012965 TGGGGAGCTCGAGAGAGAAT Chr2:72012929..72012948 61.41 55
downstream ENSMUSE00000422100 Chr2:72016235..72016356 CACATGCCAACAGCTTGAGT Chr2:72016324..72016343 59.9 50
downstream ENSMUSE00000422095 Chr2:72017977..72018160 ACGCTCGTCATCCAGAAATC Chr2:72018041..72018060 60.23 50
downstream ENSMUSE00000422089 Chr2:72033694..72033778 No primer for this exon
downstream ENSMUSE00000422084 Chr2:72034273..72034333 CACCTGCTAACTCCCGTTTC Chr2:72034297..72034316 59.73 55
downstream ENSMUSE00000422080 Chr2:72036394..72036470 CCTTCTTCCCCCTGGTTAAA Chr2:72036418..72036437 60.28 50
downstream ENSMUSE00000422075 Chr2:72036816..72036962 CTTCCCGAAGAACAATGGAG Chr2:72036912..72036931 59.67 50
downstream ENSMUSE00000422072 Chr2:72039105..72039220 TGACTGTATTCGCCTCAACG Chr2:72039129..72039148 59.86 50
downstream ENSMUSE00000422068 Chr2:72043712..72043800 GATGGCTCAAGGCGTATTGT Chr2:72043786..72043805 60.1 50
downstream ENSMUSE00000662326 Chr2:72046143..72046221 CAAAGCTGGGTATTTGGCATA Chr2:72046205..72046225 59.97 42.86
downstream ENSMUSE00000662325 Chr2:72061074..72061224 CCTGCTCGGTACCTTGAGAA Chr2:72061111..72061130 60.39 55
downstream ENSMUSE00000166211 Chr2:72063018..72063106 CATCCGTGCGTCATCTGATA Chr2:72063056..72063075 60.65 50
downstream ENSMUSE00000166204 Chr2:72063806..72063836 GTGGAGCTTTTGCGTCTTCT Chr2:72063831..72063850 59.62 50
downstream ENSMUSE00000166210 Chr2:72064056..72064134 GAATAGGCTGACGCTTCTGG Chr2:72064122..72064141 59.98 55
downstream ENSMUSE00000318424 Chr2:72064532..72064678 TTGACGATGATCAGGCCTTC Chr2:72064664..72064683 61.16 50
downstream ENSMUSE00000422041 Chr2:72067063..72067160 CATTAATGGTGAGCGTCGTAAA Chr2:72067120..72067141 60.02 40.91
downstream ENSMUSE00000422037 Chr2:72072134..72072259 CATCTGGTACGCCAGGTCTT Chr2:72072223..72072242 60.13 55
downstream ENSMUSE00000422032 Chr2:72072665..72072843 CAAGTTTGCCGTGGTCTTTT Chr2:72072727..72072746 60.15 45
downstream ENSMUSE00000422025 Chr2:72077121..72077211 GACGATGGCGAAAAAGGAAT Chr2:72077166..72077185 61.31 45
downstream ENSMUSE00000422018 Chr2:72079484..72079534 GCTCTCAAACTCCGCATAGAA Chr2:72079530..72079550 59.61 47.62
downstream ENSMUSE00000422012 Chr2:72080291..72080378 CCTGTATGCCCTGTGGTTTC Chr2:72080323..72080342 60.38 55
downstream ENSMUSE00000422008 Chr2:72080785..72080849 TTGTCAATGAACGTCTTGTTCC Chr2:72080828..72080849 60.01 40.91
downstream ENSMUSE00000422002 Chr2:72090997..72091051 GGGCTGGCTCCTGTAGTACC Chr2:72091050..72091069 61.04 65
downstream ENSMUSE00000421999 Chr2:72094306..72095529 GGCCTTCGAGGCTCTAATCT Chr2:72094432..72094451 59.95 55
downstream ENSMUSE00000566354 Chr2:72094306..72095526 GGCCTTCGAGGCTCTAATCT Chr2:72094432..72094451 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCATCTGCAGCCACTGTA Chr2:71834369..71834389 60.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGTACCTATGGAGGCTGTG Chr2:71849412..71849433 60 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049044