Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17054
Trapped Gene
Cldn14 (ENSMUSG00000047109)
Vector Insertion
Chr 16: 93942651 - 94008769
Public Clones IST10496E10 (tigm) IST10496E10 (tigm) IST13251G4 (tigm) IST11019E6 (tigm)
IST10478G5 (tigm) IST13264E2 (tigm) IST12484B7 (tigm) IST13950B6 (tigm)
IST10826C1 (tigm) IST10889E3 (tigm) IST14800F3 (tigm) IST11477D6 (tigm)
IST10361A2 (tigm) IST10084H9 (tigm) IST11965B10 (tigm) IST14917D9 (tigm)
IST11992B5 (tigm) IST12577D1HMF1 (tigm) IST14396A11 (tigm) IST12606H11 (tigm)
IST13950B6 (tigm) IST14915G11 (tigm) IST11358G11 (tigm) IST13698D7 (tigm)
IST10721B1 (tigm) IST10361B1 (tigm) IST10371F1 (tigm) IST14396A11 (tigm)
IST10024D7 (tigm) IST13792H7 (tigm) IST14745D9 (tigm) IST12316A3 (tigm)
IST14726C8 (tigm) IST14745D9 (tigm) IST14637C7 (tigm) IST11019E6 (tigm)
IST12243C6 (tigm) IST14699C3 (tigm) IST13040E3 (tigm) IST12511H1 (tigm)
IST14820C7 (tigm) IST12459D1 (tigm) IST10242C5 (tigm) IST10003B1 (tigm)
IST10414B7 (tigm) IST14637C7 (tigm)
Private Clones OST450232 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000358636 (Chr16:94008770..94009082 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGCCCTGTGGTTCATACAA Chr16:94008891..94008910 59.96 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000358636 (Chr16:94008770..94009082 -)
Downstram Exon
ENSMUSE00000345029 (Chr16:93942513..93942650 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGCCCTGTGGTTCATACAA Chr16:94008891..94008910 59.96 45 ACTGCGGCTTCAACAGTCTT Chr16:93942567..93942586 60.06 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358636 Chr16:94008770..94009082 TTGCCCTGTGGTTCATACAA Chr16:94008891..94008910 59.96 45

*** Putative Vector Insertion (Chr 16: 93942651 - 94008769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000345029 Chr16:93942513..93942650 ACTGCGGCTTCAACAGTCTT Chr16:93942567..93942586 60.06 50
downstream ENSMUSE00000381792 Chr16:93919278..93920282 GGATACGGCAGTCAGGATGT Chr16:93920045..93920064 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCATCCTTTAATCGCCTTG Chr16:93999707..93999727 59.04 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACAGAATGCTCCCTCTTGC Chr16:93999770..93999790 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTAAATGTAAACGCCGTGGTG Chr16:94000058..94000079 60.76 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTAAATGTAAACGCCGTGGTG Chr16:94000058..94000079 60.76 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047109