Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17065
Trapped Gene
Tjp2 (ENSMUSG00000024812)
Vector Insertion
Chr 19: 24207199 - 24209339
Public Clones CMHD-GT_337A4-3 (cmhd)
Private Clones OST450016 (lexicon) OST437780 (lexicon) OST431657 (lexicon) OST424362 (lexicon)
OST404435 (lexicon) OST388736 (lexicon) OST356534 (lexicon) OST352653 (lexicon)
OST339924 (lexicon) OST339341 (lexicon) OST337992 (lexicon) OST321234 (lexicon)
OST301378 (lexicon) OST294977 (lexicon) OST287961 (lexicon) OST287723 (lexicon)
OST280753 (lexicon) OST280369 (lexicon) OST273790 (lexicon) OST244485 (lexicon)
OST232805 (lexicon) OST232583 (lexicon) OST224072 (lexicon) OST221352 (lexicon)
OST211883 (lexicon) OST209437 (lexicon) OST207247 (lexicon) OST196319 (lexicon)
OST194442 (lexicon) OST193964 (lexicon) OST192603 (lexicon) OST186218 (lexicon)
OST186021 (lexicon) OST185582 (lexicon) OST176513 (lexicon) OST150426 (lexicon)
OST147122 (lexicon) OST144329 (lexicon) OST142745 (lexicon) OST142245 (lexicon)
OST138015 (lexicon) OST108667 (lexicon) OST77280 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000342686 (Chr19:24209340..24209464 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGACAACCCCCACTTTGAA Chr19:24209405..24209424 59.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000342686 (Chr19:24209340..24209464 -)
Downstram Exon
ENSMUSE00000145185 (Chr19:24207096..24207198 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGACAACCCCCACTTTGAA Chr19:24209405..24209424 59.94 50 ACGAATGGAGCACATCTTCC Chr19:24207118..24207137 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000642336 Chr19:24248445..24248522 No primer for this exon
upstream ENSMUSE00000642338 Chr19:24213269..24213322 GGCATGGAGGAGGTGATATG Chr19:24213297..24213316 60.3 55
upstream ENSMUSE00000342686 Chr19:24209340..24209464 GAGACAACCCCCACTTTGAA Chr19:24209405..24209424 59.94 50

*** Putative Vector Insertion (Chr 19: 24207199 - 24209339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145185 Chr19:24207096..24207198 ACGAATGGAGCACATCTTCC Chr19:24207118..24207137 60.08 50
downstream ENSMUSE00000145163 Chr19:24205345..24205963 CCTCCGTAGTCGGGTTCATA Chr19:24205508..24205527 59.95 55
downstream ENSMUSE00000145219 Chr19:24200195..24200298 ATGAAGGTTGCCATCTTTGG Chr19:24200194..24200213 59.93 45
downstream ENSMUSE00000145173 Chr19:24199058..24199211 CTTCCGAGCATCCGTTAGAG Chr19:24199142..24199161 59.97 55
downstream ENSMUSE00000145211 Chr19:24196753..24196861 CTGGAGAGAAAGACCGGTTG Chr19:24196801..24196820 59.84 55
downstream ENSMUSE00000145171 Chr19:24196515..24196648 TCTGCCTGAGGTCTCCTCTC Chr19:24196602..24196621 59.66 60
downstream ENSMUSE00000145168 Chr19:24195327..24195393 TTCGGGACTAGGACGAAGAA Chr19:24195322..24195341 59.81 50
downstream ENSMUSE00000145178 Chr19:24194435..24194585 ATATCCCAACGTCGTTTCCA Chr19:24194484..24194503 60.19 45
downstream ENSMUSE00000145203 Chr19:24188566..24188674 CAGGTAGAGGACCGCATCTT Chr19:24188599..24188618 59.31 55
downstream ENSMUSE00000145215 Chr19:24187236..24187446 GCCATCGTACAGCGTGTCTA Chr19:24187285..24187304 59.9 55
downstream ENSMUSE00000145165 Chr19:24185916..24186109 TTGCGGAGGTTCTTCTTGAC Chr19:24185971..24185990 60.38 50
downstream ENSMUSE00000145225 Chr19:24185511..24185606 AGAACCACGGGTCTCTTGAA Chr19:24185560..24185579 59.7 50
downstream ENSMUSE00000145191 Chr19:24184221..24184300 CGGTATTCAACCGAACCACT Chr19:24184219..24184238 59.85 50
downstream ENSMUSE00000248590 Chr19:24183135..24183345 TTTTGAGCTTGTTGGCTTGA Chr19:24183137..24183156 59.58 40
downstream ENSMUSE00000248572 Chr19:24176387..24176487 CAGACTGCTTCGTTTTGCTG Chr19:24176381..24176400 59.78 50
downstream ENSMUSE00000248553 Chr19:24175192..24175404 TGAGACGGCTGTCACAACTC Chr19:24175295..24175314 60.03 55
downstream ENSMUSE00000145177 Chr19:24173943..24174053 CGGGCTAGCATCCCTAAGTT Chr19:24173951..24173970 60.59 55
downstream ENSMUSE00000145167 Chr19:24172491..24172805 GCTCTCAGGCATAGGGACTG Chr19:24172607..24172626 59.97 60
downstream ENSMUSE00000145188 Chr19:24171074..24171159 TTGGAACCGCATAGATGTCA Chr19:24171095..24171114 60.07 45
downstream ENSMUSE00000642335 Chr19:24169160..24170080 TTCCAGACAACGGACAAACA Chr19:24169230..24169249 60.13 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGATGGCTTGCTTCAGTA Chr19:24209335..24209355 59.18 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGACACTTGCGTGACTGG Chr19:24209279..24209299 59.94 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024812