Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17078
Trapped Gene
Stk35 (ENSMUSG00000037885)
Vector Insertion
Chr 2: 129636974 - 129653509
Public Clones CMHD-GT_382E11-3 (cmhd)
Private Clones OST449707 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000507804 (Chr2:129636224..129636973 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGGATCCTGGGCTATGCT Chr2:129636227..129636246 60.06 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000507804 (Chr2:129636224..129636973 +)
Downstram Exon
ENSMUSE00000262394 (Chr2:129653510..129653723 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGGATCCTGGGCTATGCT Chr2:129636227..129636246 60.06 50 CTGTCCGAGACACGATGAGA Chr2:129653554..129653573 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641175 Chr2:129626297..129626582 TTGCTGTCATCACAAGAGCAG Chr2:129626416..129626436 60.19 47.62
upstream ENSMUSE00000706273 Chr2:129626488..129626582 No primer for this exon
upstream ENSMUSE00000262411 Chr2:129627140..129627740 GTCACGGCAACAAGAACTCA Chr2:129627684..129627703 59.88 50
upstream ENSMUSE00000507804 Chr2:129636224..129636973 AAAGGATCCTGGGCTATGCT Chr2:129636227..129636246 60.06 50

*** Putative Vector Insertion (Chr 2: 129636974 - 129653509) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000262394 Chr2:129653510..129653723 CTGTCCGAGACACGATGAGA Chr2:129653554..129653573 59.98 55
downstream ENSMUSE00000641173 Chr2:129653510..129658023 AGCTGCTACATGGGCCTCTA Chr2:129654734..129654753 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTACCAAGGGAAAGCTG Chr2:129639941..129639961 59.08 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCCTGCAACATAAACAGG Chr2:129636966..129636986 59.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037885