Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1709
Trapped Gene
Ube2l3 (ENSMUSG00000038965)
Vector Insertion
Chr 16: 17154376 - 17160082
Public Clones CF0606 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000520774 (Chr16:17160083..17160269 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAAACCACCCAAGATCACA Chr16:17160186..17160205 59.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000520774 (Chr16:17160083..17160269 -)
Downstram Exon
ENSMUSE00000703898 (Chr16:17154353..17154375 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAAACCACCCAAGATCACA Chr16:17160186..17160205 59.94 45 CAGTGCTATGAGGGACTGGA Chr16:17154331..17154350 58.83 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703894 Chr16:17202589..17202742 CCTTTCTAATGGGCACATGG Chr16:17202609..17202628 60.32 50
upstream ENSMUSE00000645501 Chr16:17201528..17201563 No primer for this exon
upstream ENSMUSE00000703893 Chr16:17201528..17201726 TTCTCTATTCCGCGCTCTTC Chr16:17201650..17201669 59.69 50
upstream ENSMUSE00000703899 Chr16:17201528..17201587 AGCAGCACCAGATCCAAGAT Chr16:17201553..17201572 59.83 50
upstream ENSMUSE00000562491 Chr16:17176505..17176600 AGCTTGAAGAGATCCGCAAA Chr16:17176580..17176599 60.1 45
upstream ENSMUSE00000520774 Chr16:17160083..17160269 TCAAACCACCCAAGATCACA Chr16:17160186..17160205 59.94 45

*** Putative Vector Insertion (Chr 16: 17154376 - 17160082) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000703898 Chr16:17154353..17154375 CAGTGCTATGAGGGACTGGA Chr16:17154331..17154350 58.83 55
downstream ENSMUSE00000629265 Chr16:17153418..17154375 TGGAAGTGGGAATCGAAAAG Chr16:17153824..17153843 60.04 45
downstream ENSMUSE00000703897 Chr16:17153403..17153607 AAGGTCACCACAAACCTGCT Chr16:17153499..17153518 59.62 50
downstream ENSMUSE00000517946 Chr16:17152106..17154375 GACGGCTTCTCTTTGTTTGC Chr16:17153637..17153656 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGGCATGCACCTTTCTTC Chr16:17157058..17157078 59.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGGCATGCACCTTTCTTC Chr16:17157058..17157078 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038965