Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17093
Trapped Gene
Dnaja1 (ENSMUSG00000028410)
Vector Insertion
Chr 4: 40669667 - 40670735
Public Clones 3SP128H07 (ggtc)
Private Clones OST449308 (lexicon) OST257959 (lexicon) OST167062 (lexicon) OST146351 (lexicon)
OST32683 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000178927 (Chr4:40669566..40669666 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000178927 (Chr4:40669566..40669666 +)
Downstram Exon
ENSMUSE00000297668 (Chr4:40670736..40670877 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATTGGGTTTTACCCCCAAAA Chr4:40670796..40670815 60.26 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000178927 Chr4:40669566..40669666 No primer for this exon

*** Putative Vector Insertion (Chr 4: 40669667 - 40670735) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297668 Chr4:40670736..40670877 ATTGGGTTTTACCCCCAAAA Chr4:40670796..40670815 60.26 40
downstream ENSMUSE00000178918 Chr4:40671006..40671183 ATATCCATGGGTGAGCCAAA Chr4:40671136..40671155 60.15 45
downstream ENSMUSE00000479344 Chr4:40673138..40673242 TGCAGAGCCAGTTTTCTTGTT Chr4:40673215..40673235 60.04 42.86
downstream ENSMUSE00000496461 Chr4:40674989..40675216 TGAACCATTCCTGGTCCAAT Chr4:40675088..40675107 60.17 45
downstream ENSMUSE00000493612 Chr4:40677206..40677320 CTCCTTCACCGTGGAATGTT Chr4:40677250..40677269 59.97 50
downstream ENSMUSE00000178919 Chr4:40678717..40678832 No primer for this exon
downstream ENSMUSE00000495417 Chr4:40679109..40679209 TATGGCCGACGGTATATTGG Chr4:40679181..40679200 60.55 50
downstream ENSMUSE00000178924 Chr4:40679761..40680932 GCAGAAGGGGATGCAATCTA Chr4:40680563..40680582 60.18 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGACCCCAGACATAATCG Chr4:40669704..40669724 60.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACACGTGACTGGGAAAACC Chr4:40669714..40669734 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028410