Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1712
Trapped Gene
Rpl13a (ENSMUSG00000003426)
Vector Insertion
Chr 7: 52382645 - 52382865
Public Clones AJ0060 (sanger) AD0728 (sanger) AX0064 (sanger) CG0792 (sanger)
XT0323 (sanger) AE0217 (sanger) AV0750 (sanger) CF0382 (sanger)
AD0298 (sanger) CSC012 (baygenomics) CSI014 (baygenomics) W061B06 (ggtc)
W064B04 (ggtc) F058B03 (ggtc) W088B02 (ggtc) PST17132-NR (escells)
Private Clones OST448993 (lexicon) OST353237 (lexicon) OST122984 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662248 (Chr7:52382866..52382938 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662248 (Chr7:52382866..52382938 -)
Downstram Exon
ENSMUSE00000203254 (Chr7:52382579..52382644 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662249 Chr7:52384070..52384107 No primer for this exon
upstream ENSMUSE00000662248 Chr7:52382866..52382938 No primer for this exon

*** Putative Vector Insertion (Chr 7: 52382645 - 52382865) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000203254 Chr7:52382579..52382644 No primer for this exon
downstream ENSMUSE00000203242 Chr7:52382361..52382462 No primer for this exon
downstream ENSMUSE00000203251 Chr7:52382079..52382164 No primer for this exon
downstream ENSMUSE00000499860 Chr7:52381848..52381907 No primer for this exon
downstream ENSMUSE00000203246 Chr7:52381485..52381607 No primer for this exon
downstream ENSMUSE00000662247 Chr7:52381293..52381402 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTAATCGCCTTGCAGCAC Chr7:52382797..52382817 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGATGAGCAACCGTGACT Chr7:52382807..52382827 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCCACAGGTTCTGGTATTGG Chr7:52382924..52382945 59.84 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCCACAGGTTCTGGTATTGG Chr7:52382924..52382945 59.84 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003426