Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17136
Trapped Gene
Pik3ca (ENSMUSG00000027665)
Vector Insertion
Chr 3: 32335072 - 32335480
Public Clones not available
Private Clones OST448712 (lexicon) OST377501 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676056 (Chr3:32335052..32335479 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCAACCGTGAAGAAAAGA Chr3:32335442..32335461 59.85 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676056 (Chr3:32335052..32335479 +)
Downstram Exon
ENSMUSE00000339248 (Chr3:32335073..32335479 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCAACCGTGAAGAAAAGA Chr3:32335442..32335461 59.85 45 CTTCACGGTTGCCTACTGGT Chr3:32335458..32335477 60.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676057 Chr3:32296593..32296722 No primer for this exon
upstream ENSMUSE00000676056 Chr3:32335052..32335479 AGGCAACCGTGAAGAAAAGA Chr3:32335442..32335461 59.85 45

*** Putative Vector Insertion (Chr 3: 32335072 - 32335480) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000339248 Chr3:32335073..32335479 CTTCACGGTTGCCTACTGGT Chr3:32335458..32335477 60.17 55
downstream ENSMUSE00000676054 Chr3:32335298..32335337 TTTCGTCTTGCAGAAGCTGA Chr3:32335326..32335345 59.86 45
downstream ENSMUSE00000171937 Chr3:32336040..32336249 GCTCTGCTATGAGGCGAGTT Chr3:32336178..32336197 59.75 55
downstream ENSMUSE00000676053 Chr3:32336040..32336249 GCTCTGCTATGAGGCGAGTT Chr3:32336178..32336197 59.75 55
downstream ENSMUSE00000272267 Chr3:32336739..32336989 TTCTGCTTGTCGTTGTTTGG Chr3:32336796..32336815 59.88 45
downstream ENSMUSE00000171915 Chr3:32338626..32338871 AGATGCGCCTGGAGTATGAC Chr3:32338749..32338768 60.25 55
downstream ENSMUSE00000171912 Chr3:32339549..32339634 TCACATAAGGGTTCTCCTCCAT Chr3:32339596..32339617 59.83 45.46
downstream ENSMUSE00000171934 Chr3:32341648..32341753 AGCACGAGGAAGATCAGGAA Chr3:32341702..32341721 59.95 50
downstream ENSMUSE00000171913 Chr3:32342501..32342653 ACAGGCCAGAGATTCAAAGC Chr3:32342595..32342614 59.43 50
downstream ENSMUSE00000171917 Chr3:32342737..32342871 TTGGCATGTTCTTCGATCAC Chr3:32342825..32342844 59.65 45
downstream ENSMUSE00000272240 Chr3:32346877..32347001 AAGTGCTCGGAGCTGTTCCT Chr3:32346942..32346961 61.49 55
downstream ENSMUSE00000272235 Chr3:32348445..32348526 TCCACTTGACAGACAGAAGCA Chr3:32348505..32348525 59.61 47.62
downstream ENSMUSE00000272231 Chr3:32348831..32348995 AAGCACCGAACAGCAAAACT Chr3:32348943..32348962 59.92 45
downstream ENSMUSE00000171904 Chr3:32349184..32349287 AAAAATGGCCAATCCTTTGA Chr3:32349274..32349293 59.39 35
downstream ENSMUSE00000171910 Chr3:32350678..32350849 CACGGCAGTAGGACTCCAAT Chr3:32350745..32350764 60.13 55
downstream ENSMUSE00000171931 Chr3:32352783..32352889 CAGGATTCAGAGGGGACAGA Chr3:32352870..32352889 60.19 55
downstream ENSMUSE00000171922 Chr3:32353301..32353422 TCTGGGTTCTCCCAATTCAA Chr3:32353369..32353388 60.43 45
downstream ENSMUSE00000171908 Chr3:32355015..32355093 TTGCCAGATGTTCTCCATGA Chr3:32355076..32355095 60.2 45
downstream ENSMUSE00000171924 Chr3:32358784..32358954 TTGAGCCATTGATGCAGTGT Chr3:32358936..32358955 60.27 45
downstream ENSMUSE00000171936 Chr3:32360402..32360519 GATAAAGGTTGCCACGCAGT Chr3:32360468..32360487 60.14 50
downstream ENSMUSE00000171929 Chr3:32360619..32360770 GCACACGTTCCCGCTTATAG Chr3:32360694..32360713 60.66 55
downstream ENSMUSE00000592904 Chr3:32361483..32362691 CAGAGCCAAGCATCATTGAA Chr3:32361574..32361593 59.95 45
downstream ENSMUSE00000676055 Chr3:32361483..32365029 CAGAGCCAAGCATCATTGAA Chr3:32361574..32361593 59.95 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000027665