Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17139
Trapped Gene
Glrx2 (ENSMUSG00000018196)
Vector Insertion
Chr 1: 145588777 - 145588842
Public Clones not available
Private Clones OST448697 (lexicon) OST439215 (lexicon) OST333392 (lexicon) OST313003 (lexicon)
OST191314 (lexicon) OST162710 (lexicon) OST145549 (lexicon) OST129027 (lexicon)
OST127190 (lexicon) OST108649 (lexicon) OST98870 (lexicon) OST82948 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000659145 (Chr1:145588778..145588841 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000659145 (Chr1:145588778..145588841 +)
Downstram Exon
ENSMUSE00000342690 (Chr1:145588778..145588841 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000659143 Chr1:145586747..145586814 No primer for this exon
upstream ENSMUSE00000538376 Chr1:145586791..145586888 No primer for this exon

*** Putative Vector Insertion (Chr 1: 145588777 - 145588842) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000342690 Chr1:145588778..145588841 No primer for this exon
downstream ENSMUSE00000659145 Chr1:145588778..145588841 No primer for this exon
downstream ENSMUSE00000158408 Chr1:145592177..145592353 No primer for this exon
downstream ENSMUSE00000595561 Chr1:145593638..145593904 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCCTTAATCGCCTTGCAG Chr1:145588822..145588842 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTCCTCGTGACTGGGAAAA Chr1:145588822..145588842 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018196