Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17151
Trapped Gene
Tmem209 (ENSMUSG00000029782)
Vector Insertion
Chr 6: 30458665 - 30458803
Public Clones not available
Private Clones OST448457 (lexicon) OST392740 (lexicon) OST291512 (lexicon) OST269825 (lexicon)
OST207678 (lexicon) OST162828 (lexicon) OST149033 (lexicon) OST145262 (lexicon)
OST136355 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701884 (Chr6:30458666..30458802 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGAGACGTAAGCCCCAAT Chr6:30458779..30458798 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701884 (Chr6:30458666..30458802 -)
Downstram Exon
ENSMUSE00000655962 (Chr6:30458666..30458802 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGAGACGTAAGCCCCAAT Chr6:30458779..30458798 59.96 50 ATTGGGGCTTACGTCTCCTT Chr6:30458757..30458776 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000660953 Chr6:30459685..30459715 GGCTTCCTGCTGAAGAACAT Chr6:30459686..30459705 59.43 50
upstream ENSMUSE00000701864 Chr6:30459685..30459718 GGCTTCCTGCTGAAGAACAT Chr6:30459686..30459705 59.43 50
upstream ENSMUSE00000711479 Chr6:30459685..30459719 GGCTTCCTGCTGAAGAACAT Chr6:30459686..30459705 59.43 50
upstream ENSMUSE00000713276 Chr6:30459685..30459719 GGCTTCCTGCTGAAGAACAT Chr6:30459686..30459705 59.43 50
upstream ENSMUSE00000655962 Chr6:30458666..30458802 AAGGAGACGTAAGCCCCAAT Chr6:30458779..30458798 59.96 50
upstream ENSMUSE00000701863 Chr6:30458666..30458842 AAGGAGACGTAAGCCCCAAT Chr6:30458779..30458798 59.96 50
upstream ENSMUSE00000701884 Chr6:30458666..30458802 AAGGAGACGTAAGCCCCAAT Chr6:30458779..30458798 59.96 50

*** Putative Vector Insertion (Chr 6: 30458665 - 30458803) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000192772 Chr6:30458454..30458512 CAGAGGGGCCAGTATGTCAC Chr6:30458440..30458459 60.53 60
downstream ENSMUSE00000192776 Chr6:30456786..30456917 CCGGGGCTAACTACCAGACT Chr6:30456796..30456815 60.51 60
downstream ENSMUSE00000192764 Chr6:30455733..30455974 CAGGCGAGTAAGTCACACCA Chr6:30455728..30455747 59.9 55
downstream ENSMUSE00000192778 Chr6:30451901..30452102 CCCACAGTGGTAGGGTATGG Chr6:30452031..30452050 60.1 60
downstream ENSMUSE00000192771 Chr6:30447818..30447993 AGGGCTGGTAGAAGGAGAGG Chr6:30447937..30447956 59.83 60
downstream ENSMUSE00000192779 Chr6:30447167..30447238 TCCATGTGATCGAGAAGCTG Chr6:30447170..30447189 59.94 50
downstream ENSMUSE00000192762 Chr6:30444738..30444834 GTAGCTCTGGACAGCCCATC Chr6:30444725..30444744 59.83 60
downstream ENSMUSE00000192765 Chr6:30442597..30442722 No primer for this exon
downstream ENSMUSE00000192775 Chr6:30441087..30441184 CTGTATCCCATTTGCGTCCT Chr6:30441085..30441104 59.96 50
downstream ENSMUSE00000192769 Chr6:30439476..30439590 CGTCTGAACGAAGTGCTGAG Chr6:30439467..30439486 59.77 55
downstream ENSMUSE00000192780 Chr6:30439293..30439390 GATTGTAGACATGCCGCTGA Chr6:30439279..30439298 59.83 50
downstream ENSMUSE00000396564 Chr6:30437375..30437448 CAAGCATTCCTGACTCTTTGG Chr6:30437354..30437374 59.86 47.62
downstream ENSMUSE00000405062 Chr6:30432961..30432985 No primer for this exon
downstream ENSMUSE00000660952 Chr6:30432801..30432985 CAAAATGTTCACGCCAGAGA Chr6:30432927..30432946 59.84 45
downstream ENSMUSE00000563976 Chr6:30432749..30432958 AGAAGGTGCAGGCTTTGCTA Chr6:30432729..30432748 60.15 50
downstream ENSMUSE00000701877 Chr6:30432419..30432985 ACAGGATGAGGTGCAGGTTC Chr6:30432609..30432628 60.12 55
downstream ENSMUSE00000701862 Chr6:30432415..30432985 ACAGGATGAGGTGCAGGTTC Chr6:30432609..30432628 60.12 55
downstream ENSMUSE00000660951 Chr6:30430797..30431137 GGAACACGTGACACACATCC Chr6:30430980..30430999 59.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGACGTAAGCCCCAATC Chr6:30458776..30458796 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAGACGTAAGCCCCAATC Chr6:30458776..30458796 60.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029782