Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17157
Trapped Gene
B2m (ENSMUSG00000060802)
Vector Insertion
Chr 2: 121973541 - 121976608
Public Clones not available
Private Clones OST448333 (lexicon) OST428475 (lexicon) OST409476 (lexicon) OST398637 (lexicon)
OST389815 (lexicon) OST372596 (lexicon) OST293591 (lexicon) OST272441 (lexicon)
OST256186 (lexicon) OST210489 (lexicon) OST203053 (lexicon) OST199195 (lexicon)
OST110785 (lexicon) OST35818 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661694 (Chr2:121973422..121973540 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACCGGCCTGTATGCTAT Chr2:121973516..121973535 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661694 (Chr2:121973422..121973540 +)
Downstram Exon
ENSMUSE00000661693 (Chr2:121976609..121976887 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACCGGCCTGTATGCTAT Chr2:121973516..121973535 60.12 55 CAGTCTCAGTGGGGGTGAAT Chr2:121976830..121976849 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661694 Chr2:121973422..121973540 CTGACCGGCCTGTATGCTAT Chr2:121973516..121973535 60.12 55

*** Putative Vector Insertion (Chr 2: 121973541 - 121976608) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661693 Chr2:121976609..121976887 CAGTCTCAGTGGGGGTGAAT Chr2:121976830..121976849 59.96 55
downstream ENSMUSE00000661692 Chr2:121977383..121977411 No primer for this exon
downstream ENSMUSE00000661691 Chr2:121978387..121978610 GCTATTTCTTTCTGCGTGCAT Chr2:121978471..121978491 59.51 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCCTCTCTTGGCATTAAA Chr2:121976555..121976575 59.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCATCTGTCCGTGACTGG Chr2:121976581..121976601 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060802