Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17159
Trapped Gene
Sertad2 (ENSMUSG00000049800)
Vector Insertion
Chr 11: 20547356 - 20547804
Public Clones D123C11 (ggtc)
Private Clones OST448309 (lexicon) OST437497 (lexicon) OST420652 (lexicon) OST347667 (lexicon)
OST308739 (lexicon) OST230691 (lexicon) OST230528 (lexicon) OST227075 (lexicon)
OST226840 (lexicon) OST215658 (lexicon) OST200852 (lexicon) OST196768 (lexicon)
OST169844 (lexicon) OST169005 (lexicon) OST128214 (lexicon) OST115185 (lexicon)
OST107703 (lexicon) OST105537 (lexicon) OST100953 (lexicon) OST98734 (lexicon)
OST42377 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680841 (Chr11:20547158..20547355 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATACCCGACAGGCAAGAAG Chr11:20547276..20547295 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680841 (Chr11:20547158..20547355 +)
Downstram Exon
ENSMUSE00000680840 (Chr11:20547805..20549068 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATACCCGACAGGCAAGAAG Chr11:20547276..20547295 59.69 55 GGGGTCAAAATCGTACATGG Chr11:20548576..20548595 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000593852 Chr11:20443256..20443763 GTATCGCCCCTTTAGCCTGT Chr11:20443494..20443513 60.47 55
upstream ENSMUSE00000680843 Chr11:20531980..20532276 CTGGAGCACGAGCTGTACCT Chr11:20532019..20532038 60.61 60
upstream ENSMUSE00000680841 Chr11:20547158..20547355 GATACCCGACAGGCAAGAAG Chr11:20547276..20547295 59.69 55

*** Putative Vector Insertion (Chr 11: 20547356 - 20547804) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000580920 Chr11:20547805..20553026 AAGCAACCAGATTGGACACC Chr11:20550326..20550345 59.97 50
downstream ENSMUSE00000680840 Chr11:20547805..20549068 GGGGTCAAAATCGTACATGG Chr11:20548576..20548595 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTTTCGCTGACTTGAGTT Chr11:20547383..20547403 58.8 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTCGTGACTGGGAAAACC Chr11:20547403..20547423 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049800