Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17175
Trapped Gene
Nme1 (ENSMUSG00000037601)
Vector Insertion
Chr 11: 93827121 - 93827252
Public Clones not available
Private Clones OST448159 (lexicon) OST382469 (lexicon) OST355222 (lexicon) OST319512 (lexicon)
OST319027 (lexicon) OST316536 (lexicon) OST277645 (lexicon) OST277643 (lexicon)
OST276648 (lexicon) OST270810 (lexicon) OST262706 (lexicon) OST165526 (lexicon)
OST117596 (lexicon) OST109446 (lexicon) OST61028 (lexicon) OST37483 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000110585 (Chr11:93827122..93827251 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATCATCAAGCGGTTCGAG Chr11:93827161..93827180 60.36 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000110585 (Chr11:93827122..93827251 -)
Downstram Exon
ENSMUSE00000713683 (Chr11:93827122..93827251 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATCATCAAGCGGTTCGAG Chr11:93827161..93827180 60.36 50 CTCGAACCGCTTGATGATCT Chr11:93827139..93827158 60.36 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376631 Chr11:93829535..93829574 GCGGTAAAGCCTTGTCATCT Chr11:93829541..93829560 59.34 50
upstream ENSMUSE00000674586 Chr11:93829535..93829586 GCGGTAAAGCCTTGTCATCT Chr11:93829541..93829560 59.34 50
upstream ENSMUSE00000110585 Chr11:93827122..93827251 AGATCATCAAGCGGTTCGAG Chr11:93827161..93827180 60.36 50
upstream ENSMUSE00000713683 Chr11:93827122..93827251 AGATCATCAAGCGGTTCGAG Chr11:93827161..93827180 60.36 50

*** Putative Vector Insertion (Chr 11: 93827121 - 93827252) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000110582 Chr11:93824541..93824642 AGCAACCACTGGTCCTGAGT Chr11:93824522..93824541 59.76 55
downstream ENSMUSE00000674585 Chr11:93822023..93822149 GGTTGGTCTCTCCAAGCATC Chr11:93822015..93822034 59.66 55
downstream ENSMUSE00000110586 Chr11:93821982..93822094 CTCGTATGGTCCCAGGCTTA Chr11:93821985..93822004 60.09 55
downstream ENSMUSE00000382394 Chr11:93820547..93820827 AGTGGCACGTAACACTGCAC Chr11:93820549..93820568 59.83 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCATTTCCCTGCTTGCTT Chr11:93827258..93827278 59.82 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCATTTCCCTGCTTGCTT Chr11:93827258..93827278 59.82 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037601