Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17183
Trapped Gene
Slc10a7 (ENSMUSG00000031684)
Vector Insertion
Chr 8: 81210483 - 81210568
Public Clones not available
Private Clones OST447871 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000606944 (Chr8:81210484..81210567 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTATGACGGTGGTGGTTCCT Chr8:81210533..81210552 60.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000606944 (Chr8:81210484..81210567 +)
Downstram Exon
ENSMUSE00000635949 (Chr8:81210484..81210567 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTATGACGGTGGTGGTTCCT Chr8:81210533..81210552 60.23 50 GGAACCACCACCGTCATAAA Chr8:81210554..81210573 60.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000404952 Chr8:81033267..81033573 AATGGTTCATGGTCGGGATA Chr8:81033502..81033521 60.01 45
upstream ENSMUSE00000445432 Chr8:81033361..81033573 AATGGTTCATGGTCGGGATA Chr8:81033502..81033521 60.01 45
upstream ENSMUSE00000211734 Chr8:81039485..81039567 CGTCGCAACGATATTCTTCA Chr8:81039522..81039541 59.83 45
upstream ENSMUSE00000581693 Chr8:81049061..81049197 ATCCATCAACGAGTGGCTTT Chr8:81049171..81049190 59.56 45
upstream ENSMUSE00000581696 Chr8:81049061..81049197 ATCCATCAACGAGTGGCTTT Chr8:81049171..81049190 59.56 45
upstream ENSMUSE00000249095 Chr8:81054982..81055057 AAGGCAGTTGGTGGAAATGA Chr8:81055037..81055056 60.49 45
upstream ENSMUSE00000581692 Chr8:81054982..81055057 AAGGCAGTTGGTGGAAATGA Chr8:81055037..81055056 60.49 45
upstream ENSMUSE00000249088 Chr8:81102618..81102656 No primer for this exon
upstream ENSMUSE00000606946 Chr8:81102618..81102656 No primer for this exon
upstream ENSMUSE00000249083 Chr8:81186886..81186921 ATTGTTGTGACTCCGGTGCT Chr8:81186889..81186908 60.58 50
upstream ENSMUSE00000606945 Chr8:81186886..81186921 ATTGTTGTGACTCCGGTGCT Chr8:81186889..81186908 60.58 50

*** Putative Vector Insertion (Chr 8: 81210483 - 81210568) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000606944 Chr8:81210484..81210567 GGAACCACCACCGTCATAAA Chr8:81210554..81210573 60.62 50
downstream ENSMUSE00000635949 Chr8:81210484..81210567 GGAACCACCACCGTCATAAA Chr8:81210554..81210573 60.62 50
downstream ENSMUSE00000211723 Chr8:81221065..81221230 GCTACTGCTGACCACACCAA Chr8:81221136..81221155 59.9 55
downstream ENSMUSE00000606943 Chr8:81221065..81221230 GCTACTGCTGACCACACCAA Chr8:81221136..81221155 59.9 55
downstream ENSMUSE00000211729 Chr8:81222419..81222470 AAGCTCAGCTGAACGGAGAC Chr8:81222443..81222462 59.75 55
downstream ENSMUSE00000682022 Chr8:81222419..81222470 AAGCTCAGCTGAACGGAGAC Chr8:81222443..81222462 59.75 55
downstream ENSMUSE00000211727 Chr8:81230774..81230847 TGGTGTGAACCCCGAGTTAT Chr8:81230798..81230817 60.23 50
downstream ENSMUSE00000682021 Chr8:81230774..81230847 TGGTGTGAACCCCGAGTTAT Chr8:81230798..81230817 60.23 50
downstream ENSMUSE00000211728 Chr8:81253517..81253662 CTCATGGCCTGCAAACACTA Chr8:81253557..81253576 59.86 50
downstream ENSMUSE00000606942 Chr8:81253517..81253662 CTCATGGCCTGCAAACACTA Chr8:81253557..81253576 59.86 50
downstream ENSMUSE00000341040 Chr8:81255508..81256050 CTGCACAAAGGCAGTACGAA Chr8:81255848..81255867 60.05 50
downstream ENSMUSE00000581694 Chr8:81255508..81257902 GAGGTACCTGACGCTTCTCG Chr8:81256058..81256077 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATTCACAGCAAGCCTCAC Chr8:81210445..81210465 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATTCACAGCAAGCCTCAC Chr8:81210445..81210465 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031684