Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17188
Trapped Gene
Dhdh (ENSMUSG00000011382)
Vector Insertion
Chr 7: 52743542 - 52744043
Public Clones IST13604G3 (tigm)
Private Clones OST447767 (lexicon) OST433844 (lexicon) OST319008 (lexicon) OST240346 (lexicon)
OST118808 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000344844 (Chr7:52744044..52744166 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000344844 (Chr7:52744044..52744166 -)
Downstram Exon
ENSMUSE00000203813 (Chr7:52743430..52743541 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344844 Chr7:52744044..52744166 No primer for this exon

*** Putative Vector Insertion (Chr 7: 52743542 - 52744043) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000203813 Chr7:52743430..52743541 No primer for this exon
downstream ENSMUSE00000203807 Chr7:52742111..52742274 No primer for this exon
downstream ENSMUSE00000203811 Chr7:52737159..52737411 No primer for this exon
downstream ENSMUSE00000203806 Chr7:52734379..52734503 No primer for this exon
downstream ENSMUSE00000203814 Chr7:52730975..52731122 No primer for this exon
downstream ENSMUSE00000350626 Chr7:52728933..52730745 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGTGGAGCCGAGGTAAT Chr7:52743988..52744008 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCTGAGCTCACTGCCTTC Chr7:52744055..52744075 61.31 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr7:52744097..52744117 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGCAGAAGACGTGCAAAATG Chr7:52744129..52744149 61.75 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000011382