Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17198
Trapped Gene
Son (ENSMUSG00000022961)
Vector Insertion
Chr 16: 91648230 - 91651874
Public Clones D125A06 (ggtc) P100H08 (ggtc) PST16978-NL (escells) IST12497B10 (tigm)
IST12655C12 (tigm) IST12639E5 (tigm) IST12497C6 (tigm) IST12496H9 (tigm)
IST12540E8 (tigm) IST11436F1 (tigm) IST12497H8 (tigm)
Private Clones OST447653 (lexicon) OST412372 (lexicon) OST411044 (lexicon) OST394778 (lexicon)
OST331860 (lexicon) OST303139 (lexicon) OST283874 (lexicon) OST265351 (lexicon)
OST207088 (lexicon) OST187952 (lexicon) OST139753 (lexicon) OST113625 (lexicon)
OST78393 (lexicon) OST61523 (lexicon) OST38284 (lexicon) OST33517 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000248625 (Chr16:91648069..91648229 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000248625 (Chr16:91648069..91648229 +)
Downstram Exon
ENSMUSE00000132163 (Chr16:91651875..91652041 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50 TCATTTGGGAGACTCCTTGC Chr16:91651976..91651995 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718814 Chr16:91647751..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000248625 Chr16:91648069..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000709905 Chr16:91648124..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000715014 Chr16:91648130..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50

*** Putative Vector Insertion (Chr 16: 91648230 - 91651874) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132163 Chr16:91651875..91652041 TCATTTGGGAGACTCCTTGC Chr16:91651976..91651995 60.19 50
downstream ENSMUSE00000248612 Chr16:91654856..91656948 ATTGTTACAACGGGCTCAGG Chr16:91655402..91655421 59.99 50
downstream ENSMUSE00000697861 Chr16:91654856..91660825 ATTGTTACAACGGGCTCAGG Chr16:91655402..91655421 59.99 50
downstream ENSMUSE00000248597 Chr16:91657069..91660825 CAGCGGGGGTTTTTACTACA Chr16:91658776..91658795 59.99 50
downstream ENSMUSE00000421977 Chr16:91662346..91662506 GGAGGTGCAGGCTTTAGGTT Chr16:91662445..91662464 60.63 55
downstream ENSMUSE00000697840 Chr16:91662737..91663553 CTCTTGGCGATCAGTGAACA Chr16:91662867..91662886 59.98 50
downstream ENSMUSE00000248551 Chr16:91664443..91664589 AAAATGGGCTTGGGTTCACT Chr16:91664579..91664598 60.72 45
downstream ENSMUSE00000248543 Chr16:91664879..91665067 TACTTGGCTTTTCGGTGGAG Chr16:91664920..91664939 60.24 50
downstream ENSMUSE00000718854 Chr16:91665165..91665953 CTGCAATTCGATGCTTTTCA Chr16:91665294..91665313 59.95 40
downstream ENSMUSE00000248535 Chr16:91670709..91670819 CCGTTCTTGAGCTCGGTTTA Chr16:91670822..91670841 60.38 50
downstream ENSMUSE00000555840 Chr16:91671594..91671710 GTGAACTGCCCAGGGATAGA Chr16:91671640..91671659 60.07 55
downstream ENSMUSE00000393322 Chr16:91675646..91675793 TCAAAACAGCTCCCATTCCT Chr16:91675700..91675719 59.67 45
downstream ENSMUSE00000248514 Chr16:91677650..91677721 CCAGAACGCTTTTGTGCTCT Chr16:91677692..91677711 60.57 50
downstream ENSMUSE00000248507 Chr16:91677834..91677949 AGAGGAAATGTTTGCGATGG Chr16:91677947..91677966 60.07 45
downstream ENSMUSE00000394089 Chr16:91678346..91679437 AAGTGGCATTAGCCATGAGG Chr16:91678534..91678553 60.1 50
downstream ENSMUSE00000716529 Chr16:91678346..91679466 AAGTGGCATTAGCCATGAGG Chr16:91678534..91678553 60.1 50
downstream ENSMUSE00000714116 Chr16:91678399..91679452 AAGTGGCATTAGCCATGAGG Chr16:91678534..91678553 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCGGGAAATACAACAGGAG Chr16:91651203..91651223 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATCGTGACTGGGAAAACC Chr16:91651277..91651297 60.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022961