Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1720
Trapped Gene
Eif4e (ENSMUSG00000028156)
Vector Insertion
Chr 3: 138213291 - 138213856
Public Clones AA0052 (sanger) AP0761 (sanger) CF0006 (sanger) AC0196 (sanger)
CA0228 (sanger) AC0177 (sanger) CG0690 (sanger) AQ0132 (sanger)
AC0173 (sanger) AD0601 (sanger) AC0181 (sanger) AC0188 (sanger)
AA0047 (sanger) CF0490 (sanger) AM0289 (sanger) CD0043 (sanger)
AC0180 (sanger)
Private Clones OST207758 (lexicon) OST201876 (lexicon) OST187216 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176797 (Chr3:138213227..138213290 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATTTAATGCCTGGCTGTGAC Chr3:138213255..138213275 59.1 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176797 (Chr3:138213227..138213290 +)
Downstram Exon
ENSMUSE00000238571 (Chr3:138213857..138213970 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATTTAATGCCTGGCTGTGAC Chr3:138213255..138213275 59.1 42.86 GATCGAGGTCACTCCGTCTC Chr3:138213956..138213975 59.8 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669180 Chr3:138190249..138190278 TCTAAGATGGCGACTGTGGA Chr3:138190255..138190274 59.39 50
upstream ENSMUSE00000176798 Chr3:138209285..138209391 TACCACTAATCCCCCACCTG Chr3:138209296..138209315 59.67 55
upstream ENSMUSE00000176794 Chr3:138210623..138210718 No primer for this exon
upstream ENSMUSE00000176797 Chr3:138213227..138213290 AATTTAATGCCTGGCTGTGAC Chr3:138213255..138213275 59.1 42.86

*** Putative Vector Insertion (Chr 3: 138213291 - 138213856) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238571 Chr3:138213857..138213970 GATCGAGGTCACTCCGTCTC Chr3:138213956..138213975 59.8 60
downstream ENSMUSE00000176799 Chr3:138216546..138216685 TTCTCCAATAAGGCACAGCA Chr3:138216569..138216588 59.42 45
downstream ENSMUSE00000635611 Chr3:138218354..138219596 GTGCATGGGGAAGACACTCT Chr3:138219526..138219545 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCATTCATAATCGCCTTGC Chr3:138213334..138213354 59.93 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTAATGCCTGGCTGTGACT Chr3:138213258..138213278 58.38 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028156