Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17201
Trapped Gene
Fez1 (ENSMUSG00000032118)
Vector Insertion
Chr 9: 36640497 - 36651246
Public Clones not available
Private Clones OST447632 (lexicon) OST438377 (lexicon) OST438248 (lexicon) OST427688 (lexicon)
OST347029 (lexicon) OST346181 (lexicon) OST344977 (lexicon) OST315324 (lexicon)
OST302190 (lexicon) OST282997 (lexicon) OST280612 (lexicon) OST273811 (lexicon)
OST268865 (lexicon) OST259735 (lexicon) OST240575 (lexicon) OST238292 (lexicon)
OST185840 (lexicon) OST167488 (lexicon) OST149134 (lexicon) OST131541 (lexicon)
OST130746 (lexicon) OST130595 (lexicon) OST112280 (lexicon) OST76174 (lexicon)
OST64435 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637917 (Chr9:36640394..36640496 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCTCTAGTCGGTGGTTGG Chr9:36640425..36640444 60.56 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637917 (Chr9:36640394..36640496 +)
Downstram Exon
ENSMUSE00000360008 (Chr9:36651247..36651602 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCTCTAGTCGGTGGTTGG Chr9:36640425..36640444 60.56 60 GAGGTCCTCCATGGACTTGA Chr9:36651480..36651499 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637917 Chr9:36640394..36640496 CACCTCTAGTCGGTGGTTGG Chr9:36640425..36640444 60.56 60

*** Putative Vector Insertion (Chr 9: 36640497 - 36651246) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000360008 Chr9:36651247..36651602 GAGGTCCTCCATGGACTTGA Chr9:36651480..36651499 60.05 55
downstream ENSMUSE00000226569 Chr9:36657932..36658031 TCAGAGCTGTTGCCATTCAG Chr9:36658027..36658046 60.14 50
downstream ENSMUSE00000226546 Chr9:36668397..36668483 GAGAGGCTCCTCATTGATGC Chr9:36668471..36668490 59.92 55
downstream ENSMUSE00000216694 Chr9:36671082..36671250 GACTGAATCTGCCTGGGATG Chr9:36671195..36671214 60.62 55
downstream ENSMUSE00000216708 Chr9:36675281..36675552 GCAGGCTTAACCCCTTCTCT Chr9:36675514..36675533 59.85 55
downstream ENSMUSE00000216705 Chr9:36676433..36676513 TCCTGAGGAGCCAAAGGTCT Chr9:36676504..36676523 61.3 55
downstream ENSMUSE00000584724 Chr9:36678066..36678141 CATCTGCAGGTCTTCCACAG Chr9:36678134..36678153 59.42 55
downstream ENSMUSE00000411250 Chr9:36683882..36683947 CTCCTTCATGGCGAAGAGAA Chr9:36683904..36683923 60.47 50
downstream ENSMUSE00000701629 Chr9:36686151..36686505 GAGGCTGCTCCAAAGATGAG Chr9:36686191..36686210 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCCTGTGATCCAGGAAAT Chr9:36640479..36640499 60.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTCCCAAATCCGTGACTG Chr9:36640536..36640556 60.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032118