Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17211
Trapped Gene
Rab3d (ENSMUSG00000019066)
Vector Insertion
Chr 9: 21720148 - 21720388
Public Clones not available
Private Clones OST447527 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715710 (Chr9:21720149..21720510 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715710 (Chr9:21720149..21720510 -)
Downstram Exon
ENSMUSE00000708556 (Chr9:21720149..21720387 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349206 Chr9:21722466..21722565 No primer for this exon
upstream ENSMUSE00000713965 Chr9:21722466..21722561 No primer for this exon
upstream ENSMUSE00000721712 Chr9:21722466..21722583 No primer for this exon
upstream ENSMUSE00000702576 Chr9:21720149..21720387 No primer for this exon
upstream ENSMUSE00000708556 Chr9:21720149..21720387 No primer for this exon
upstream ENSMUSE00000715710 Chr9:21720149..21720510 No primer for this exon

*** Putative Vector Insertion (Chr 9: 21720148 - 21720388) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000538230 Chr9:21719307..21719425 No primer for this exon
downstream ENSMUSE00000217815 Chr9:21719089..21719213 No primer for this exon
downstream ENSMUSE00000702574 Chr9:21713470..21715115 No primer for this exon
downstream ENSMUSE00000720754 Chr9:21713086..21713325 No primer for this exon
downstream ENSMUSE00000719940 Chr9:21711954..21715115 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATAATCGCCTTGCAGCAC Chr9:21720320..21720340 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATGGCATCCGCTAGTGAG Chr9:21720357..21720377 60.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019066