Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17212
Trapped Gene
Keap1 (ENSMUSG00000003308)
Vector Insertion
Chr 9: 21035871 - 21036140
Public Clones not available
Private Clones OST447520 (lexicon) OST447379 (lexicon) OST425292 (lexicon) OST425291 (lexicon)
OST184789 (lexicon) OST72891 (lexicon) OST34122 (lexicon)
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217385 (Chr9:21036141..21036346 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217385 (Chr9:21036141..21036346 -)
Downstram Exon
ENSMUSE00000217386 (Chr9:21035694..21035870 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518000 Chr9:21043237..21043261 No primer for this exon
upstream ENSMUSE00000217382 Chr9:21041515..21042200 No primer for this exon
upstream ENSMUSE00000217388 Chr9:21037832..21038517 No primer for this exon
upstream ENSMUSE00000217385 Chr9:21036141..21036346 No primer for this exon

*** Putative Vector Insertion (Chr 9: 21035871 - 21036140) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217386 Chr9:21035694..21035870 No primer for this exon
downstream ENSMUSE00000474225 Chr9:21034511..21035312 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATCACACCGATGAATACCA Chr9:21036154..21036175 59.79 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATCACACCGATGAATACCA Chr9:21036154..21036175 59.79 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003308