Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17232
Trapped Gene
Sepw1 (ENSMUSG00000041571)
Vector Insertion
Chr 7: 16502889 - 16505196
Public Clones not available
Private Clones OST447138 (lexicon) OST281481 (lexicon) OST147807 (lexicon) OST90670 (lexicon)
OST67176 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000408718 (Chr7:16505197..16505295 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGTTCCGGAAACTGGTGAC Chr7:16505246..16505265 59.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000408718 (Chr7:16505197..16505295 -)
Downstram Exon
ENSMUSE00000637138 (Chr7:16502559..16502888 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGTTCCGGAAACTGGTGAC Chr7:16505246..16505265 59.04 50 GGAACATCGAGGAAAGACCA Chr7:16502775..16502794 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637142 Chr7:16507601..16507720 GAGCTTGAGGTCCTTGTTGC Chr7:16507675..16507694 60 55
upstream ENSMUSE00000637140 Chr7:16505798..16505822 No primer for this exon
upstream ENSMUSE00000637139 Chr7:16505654..16505707 No primer for this exon
upstream ENSMUSE00000331484 Chr7:16505392..16505466 GTGACAGTAGCCGGGAAGTT Chr7:16505408..16505427 59.21 55
upstream ENSMUSE00000408718 Chr7:16505197..16505295 AAGTTCCGGAAACTGGTGAC Chr7:16505246..16505265 59.04 50

*** Putative Vector Insertion (Chr 7: 16502889 - 16505196) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000637138 Chr7:16502559..16502888 GGAACATCGAGGAAAGACCA Chr7:16502775..16502794 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCGTATTAATCGCCTTGC Chr7:16505133..16505153 58.8 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGTATCGTGACTGGGAAAAC Chr7:16505130..16505151 59.99 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041571