Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17235
Trapped Gene
Ccpg1 (ENSMUSG00000034563)
Vector Insertion
Chr 9: 72833481 - 72845208
Public Clones (sanger) (sanger) D137A03 (ggtc) D137A03 (ggtc) IST14287B1 (tigm)
IST15068A6 (tigm) IST14539C6 (tigm) IST12794A1 (tigm) IST14175E3 (tigm)
IST14313H10 (tigm) IST10602H2 (tigm) IST14191H11 (tigm) IST10890G11 (tigm)
IST10548C4 (tigm) IST11097H6 (tigm) IST15068A7 (tigm) IST14510A8 (tigm)
IST14508D7 (tigm) IST13571C3 (tigm) IST12794A1 (tigm)
Private Clones OST447105 (lexicon) OST415504 (lexicon) OST328419 (lexicon) OST319709 (lexicon)
OST280687 (lexicon) OST272796 (lexicon) OST252394 (lexicon) OST207439 (lexicon)
OST184491 (lexicon) OST168520 (lexicon) OST150478 (lexicon) OST138616 (lexicon)
OST101493 (lexicon) OST77416 (lexicon) OST41302 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217685 (Chr9:72833385..72833480 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTTTATGAGGCGTCACTGG Chr9:72833394..72833413 58.77 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217685 (Chr9:72833385..72833480 +)
Downstram Exon
ENSMUSE00000217687 (Chr9:72845209..72845277 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTTTATGAGGCGTCACTGG Chr9:72833394..72833413 58.77 45 CCACAAGATGAGTCGCTGTC Chr9:72845258..72845277 59.42 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000217685 Chr9:72833385..72833480 TTTTTATGAGGCGTCACTGG Chr9:72833394..72833413 58.77 45

*** Putative Vector Insertion (Chr 9: 72833481 - 72845208) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217687 Chr9:72845209..72845277 CCACAAGATGAGTCGCTGTC Chr9:72845258..72845277 59.42 55
downstream ENSMUSE00000217684 Chr9:72846831..72846951 ATAAAGAACGGGCAGCTCCT Chr9:72846935..72846954 60.23 50
downstream ENSMUSE00000217690 Chr9:72847270..72847346 TCCCACTGACGATGTGTTGT Chr9:72847304..72847323 60.01 50
downstream ENSMUSE00000307246 Chr9:72849484..72849682 GGGCGCTTCTTGAATTGTAA Chr9:72849618..72849637 60.21 45
downstream ENSMUSE00000423253 Chr9:72853448..72853699 CTGGTGTCATCGCTACTGGA Chr9:72853499..72853518 59.85 55
downstream ENSMUSE00000423250 Chr9:72858104..72858219 CAGCTCATCTTCGTGGGTCT Chr9:72858159..72858178 60.41 55
downstream ENSMUSE00000307195 Chr9:72859737..72860799 TTTTCAGTTGCCGCTTCTTT Chr9:72860596..72860615 60 40
downstream ENSMUSE00000423265 Chr9:72859737..72861133 TTTTCAGTTGCCGCTTCTTT Chr9:72860596..72860615 60 40
downstream ENSMUSE00000583982 Chr9:72863139..72863798 ACTGCCCCAGTTCTAGCTCA Chr9:72863308..72863327 60.01 55
downstream ENSMUSE00000695934 Chr9:72863139..72863798 ACTGCCCCAGTTCTAGCTCA Chr9:72863308..72863327 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATAATCGCCTTGCAGCACAT Chr9:72836530..72836551 61.86 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGACGTGACTGGGAAAAC Chr9:72836527..72836547 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034563