Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17237
Trapped Gene
Smad6 (ENSMUSG00000036867)
Vector Insertion
Chr 9: 63801864 - 63855337
Public Clones IST14914C10 (tigm) IST13036D12 (tigm)
Private Clones OST447088 (lexicon) OST393074 (lexicon) OST368616 (lexicon) OST341300 (lexicon)
OST332612 (lexicon) OST280441 (lexicon) OST199499 (lexicon) OST169711 (lexicon)
OST46701 (lexicon)
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000323878 (Chr9:63855338..63855415 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACTCCCTCATCACTGCT Chr9:63855354..63855373 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000323878 (Chr9:63855338..63855415 -)
Downstram Exon
ENSMUSE00000340783 (Chr9:63800953..63801863 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACTCCCTCATCACTGCT Chr9:63855354..63855373 60.26 55 CTGGTCGTACACCGCATAGA Chr9:63801738..63801757 59.74 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000399322 Chr9:63868012..63869866 CAGTGTGCGTTTGAGGAGAA Chr9:63869790..63869809 60.03 50
upstream ENSMUSE00000323892 Chr9:63860022..63860078 ATTCTCGGCTGTCTCCTCCT Chr9:63860041..63860060 60.36 55
upstream ENSMUSE00000323878 Chr9:63855338..63855415 CCAACTCCCTCATCACTGCT Chr9:63855354..63855373 60.26 55

*** Putative Vector Insertion (Chr 9: 63801864 - 63855337) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000340783 Chr9:63800953..63801863 CTGGTCGTACACCGCATAGA Chr9:63801738..63801757 59.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCCTGTGAGCAGACAGATA Chr9:63837314..63837334 58.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGCGTGACTGGGAAAAC Chr9:63837271..63837291 61.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGAACCCTGATTGTGGTTGC Chr9:63801414..63801434 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGAACCCTGATTGTGGTTGC Chr9:63801414..63801434 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036867