Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1724
Trapped Gene
Eif4e (ENSMUSG00000028156)
Vector Insertion
Chr 3: 138210719 - 138213226
Public Clones CF0193 (sanger) AK0029 (sanger) CG0584 (sanger) AA0060 (sanger)
IST14606D8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176794 (Chr3:138210623..138210718 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176794 (Chr3:138210623..138210718 +)
Downstram Exon
ENSMUSE00000176797 (Chr3:138213227..138213290 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGTCACAGCCAGGCATTAAA Chr3:138213279..138213298 58.38 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669180 Chr3:138190249..138190278 TCTAAGATGGCGACTGTGGA Chr3:138190255..138190274 59.39 50
upstream ENSMUSE00000176798 Chr3:138209285..138209391 TACCACTAATCCCCCACCTG Chr3:138209296..138209315 59.67 55
upstream ENSMUSE00000176794 Chr3:138210623..138210718 No primer for this exon

*** Putative Vector Insertion (Chr 3: 138210719 - 138213226) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176797 Chr3:138213227..138213290 AGTCACAGCCAGGCATTAAA Chr3:138213279..138213298 58.38 45
downstream ENSMUSE00000238571 Chr3:138213857..138213970 GATCGAGGTCACTCCGTCTC Chr3:138213956..138213975 59.8 60
downstream ENSMUSE00000176799 Chr3:138216546..138216685 TTCTCCAATAAGGCACAGCA Chr3:138216569..138216588 59.42 45
downstream ENSMUSE00000635611 Chr3:138218354..138219596 GTGCATGGGGAAGACACTCT Chr3:138219526..138219545 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTAATCGCCTTGCAGCAC Chr3:138210767..138210787 61.26 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGAAGACTTTTGGGCGTAAG Chr3:138210704..138210725 59.39 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028156