Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17243
Trapped Gene
Rit2 (ENSMUSG00000057455)
Vector Insertion
Chr 18: 31402832 - 31476494
Public Clones not available
Private Clones OST446887 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000479250 (Chr18:31476495..31476620 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGGTCCAGAGAGTACAAG Chr18:31476532..31476551 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000479250 (Chr18:31476495..31476620 -)
Downstram Exon
ENSMUSE00000487874 (Chr18:31402775..31402831 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGGTCCAGAGAGTACAAG Chr18:31476532..31476551 59.87 60 TTGTGGGGTCGTGATAGTCC Chr18:31402756..31402775 60.78 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479250 Chr18:31476495..31476620 GCGGGTCCAGAGAGTACAAG Chr18:31476532..31476551 59.87 60

*** Putative Vector Insertion (Chr 18: 31402832 - 31476494) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487874 Chr18:31402775..31402831 TTGTGGGGTCGTGATAGTCC Chr18:31402756..31402775 60.78 55
downstream ENSMUSE00000140328 Chr18:31372312..31372385 TCAATCCTCACCTGGGTTTT Chr18:31372333..31372352 59.38 45
downstream ENSMUSE00000471880 Chr18:31313359..31313550 GTGTGACGGACCTGGAAAAT Chr18:31313395..31313414 59.83 50
downstream ENSMUSE00000625601 Chr18:31132777..31135158 GATTCATTGAGAGGGGCAAA Chr18:31134146..31134165 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGTGTTTTATGGGATGGAG Chr18:31467518..31467538 60.18 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACGTGACTGGGAAAACC Chr18:31467427..31467447 60.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057455