Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17257
Trapped Gene
Mapk1ip1 (ENSMUSG00000041775)
Vector Insertion
Chr 7: 146027505 - 146028714
Public Clones CMHD-GT_235D8-3 (cmhd)
Private Clones OST446572 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000468144 (Chr7:146027531..146028713 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCCCGAATAATCCTTACCC Chr7:146027934..146027953 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000468144 (Chr7:146027531..146028713 -)
Downstram Exon
ENSMUSE00000711209 (Chr7:146027506..146028713 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCCCGAATAATCCTTACCC Chr7:146027934..146027953 59.98 50 AGGACCAACTGGATCTGTGG Chr7:146028154..146028173 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000470206 Chr7:146037640..146037943 CGACGCCCTCTACGTTCTTA Chr7:146037812..146037831 60.4 55
upstream ENSMUSE00000710036 Chr7:146037640..146037940 CGACGCCCTCTACGTTCTTA Chr7:146037812..146037831 60.4 55
upstream ENSMUSE00000719338 Chr7:146037640..146037956 CGACGCCCTCTACGTTCTTA Chr7:146037812..146037831 60.4 55
upstream ENSMUSE00000716184 Chr7:146032260..146032617 TAGCGCTGACCTTTGACCTT Chr7:146032322..146032341 60.01 50
upstream ENSMUSE00000714995 Chr7:146027561..146028609 TCCCCGAATAATCCTTACCC Chr7:146027934..146027953 59.98 50
upstream ENSMUSE00000468144 Chr7:146027531..146028713 TCCCCGAATAATCCTTACCC Chr7:146027934..146027953 59.98 50
upstream ENSMUSE00000711209 Chr7:146027506..146028713 TCCCCGAATAATCCTTACCC Chr7:146027934..146027953 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000041775