Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17261
Trapped Gene
Prtg (ENSMUSG00000036030)
Vector Insertion
Chr 9: 72657565 - 72690501
Public Clones (ggtc) (ggtc) (ggtc) (ggtc) IST12706F9 (tigm) IST14785D7 (tigm)
IST11940H10 (tigm) IST14162D11 (tigm) IST10143A2 (tigm) IST13888D7 (tigm)
IST12091B4 (tigm) IST13334B6 (tigm) IST10865E5 (tigm) IST11779F11 (tigm)
IST12839B5 (tigm) IST13331C12 (tigm) IST14877D12 (tigm) IST13832A3 (tigm)
IST11963E8 (tigm) IST10806A3 (tigm) IST14495D2 (tigm) IST14239C11 (tigm)
IST12586F1 (tigm) IST10143A2 (tigm) IST14128F4 (tigm) IST14746F6 (tigm)
IST12419A6 (tigm) IST10070F6 (tigm) IST13883D12 (tigm) IST11109C4 (tigm)
IST15112F8 (tigm) IST12586F1 (tigm) IST10827G6 (tigm) IST12135F12 (tigm)
IST11983D10 (tigm) IST12135F12 (tigm) IST13826G10 (tigm) IST13588E8 (tigm)
IST10970B2 (tigm) IST12091B4 (tigm) IST11385D9 (tigm) IST12843A7 (tigm)
IST11042C7 (tigm) IST14936B2 (tigm) IST12679C8 (tigm) IST14276B9 (tigm)
IST13677D3 (tigm) IST13643D6 (tigm) IST12915F11 (tigm) IST14413E5 (tigm)
IST14559H5 (tigm) IST12778G8 (tigm) IST12500B9 (tigm) IST14226A4 (tigm)
IST15019C6 (tigm) IST10246E10 (tigm) IST12203H10 (tigm) IST13967C3 (tigm)
IST14877D12 (tigm)
Private Clones OST446512 (lexicon) OST441517 (lexicon) OST423980 (lexicon) OST354037 (lexicon)
OST338818 (lexicon) OST338531 (lexicon) OST303701 (lexicon) OST300626 (lexicon)
OST300359 (lexicon) OST293498 (lexicon) OST288089 (lexicon) OST278969 (lexicon)
OST278541 (lexicon) OST272137 (lexicon) OST249232 (lexicon) OST248936 (lexicon)
OST193348 (lexicon) OST187636 (lexicon) OST166778 (lexicon) OST139244 (lexicon)
OST134034 (lexicon) OST132173 (lexicon) OST130258 (lexicon) OST124113 (lexicon)
OST110589 (lexicon) OST97949 (lexicon) OST45714 (lexicon) OST38511 (lexicon)
OST38395 (lexicon) OST37838 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635589 (Chr9:72657262..72657564 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAATACGGGGCCATTCTTA Chr9:72657518..72657537 59.79 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635589 (Chr9:72657262..72657564 +)
Downstram Exon
ENSMUSE00000309286 (Chr9:72690502..72690646 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAATACGGGGCCATTCTTA Chr9:72657518..72657537 59.79 45 CACTGGATGGACTTCAAACG Chr9:72690533..72690552 59.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635590 Chr9:72655018..72655339 CTGCTGCTGTTGCTGCTACT Chr9:72655297..72655316 59.56 55
upstream ENSMUSE00000635589 Chr9:72657262..72657564 CAAATACGGGGCCATTCTTA Chr9:72657518..72657537 59.79 45

*** Putative Vector Insertion (Chr 9: 72657565 - 72690501) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000309286 Chr9:72690502..72690646 CACTGGATGGACTTCAAACG Chr9:72690533..72690552 59.13 50
downstream ENSMUSE00000309264 Chr9:72692665..72692798 GTAGCTGCAACACAGCGGTA Chr9:72692751..72692770 60.08 55
downstream ENSMUSE00000407802 Chr9:72695716..72695853 AGACGGCTCCAGGAAATGAT Chr9:72695854..72695873 60.99 50
downstream ENSMUSE00000309215 Chr9:72696121..72696279 GGCCCGACAAACATACACTC Chr9:72696227..72696246 60.38 55
downstream ENSMUSE00000309192 Chr9:72697559..72697718 AGGCCATTCGACAAATGAAG Chr9:72697587..72697606 60.07 45
downstream ENSMUSE00000309167 Chr9:72699288..72699535 TCGTCTTCCGGGATAATCTG Chr9:72699326..72699345 60.03 50
downstream ENSMUSE00000309138 Chr9:72702763..72702927 TGAGTCGTGTCGTTTCCAAG Chr9:72702814..72702833 59.87 50
downstream ENSMUSE00000389884 Chr9:72704582..72704887 AACTTGGATGGCGTTCTCAG Chr9:72704736..72704755 60.26 50
downstream ENSMUSE00000332741 Chr9:72706568..72706756 CAGCTTGTAGCCCCGAATAG Chr9:72706677..72706696 59.86 55
downstream ENSMUSE00000375893 Chr9:72738584..72738679 CAGGAGCCTCACGTGGTATT Chr9:72738618..72738637 60.13 55
downstream ENSMUSE00000340670 Chr9:72739616..72739802 AGAGGAGGTATTCGCCTTCG Chr9:72739689..72739708 60.72 55
downstream ENSMUSE00000383878 Chr9:72740035..72740162 GACAGCTGATCCACATGCAG Chr9:72740121..72740140 60.44 55
downstream ENSMUSE00000347876 Chr9:72741631..72741801 TGGTGTAGCGTGTCACCACT Chr9:72741744..72741763 60.23 55
downstream ENSMUSE00000393523 Chr9:72752512..72752694 GGTTCGACTCTGAAGCATCC Chr9:72752661..72752680 59.81 55
downstream ENSMUSE00000338515 Chr9:72753955..72754075 GGCTTTGCTTCGGTAGATCA Chr9:72754076..72754095 60.35 50
downstream ENSMUSE00000384050 Chr9:72755508..72755670 TTCCACTCTGCGCTGTCTTA Chr9:72755545..72755564 59.74 50
downstream ENSMUSE00000387136 Chr9:72758444..72758548 No primer for this exon
downstream ENSMUSE00000352082 Chr9:72759711..72761965 TAAAAGCAGACGGCCTGAGT Chr9:72759748..72759767 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGCTTCCCAGGTCTTTAG Chr9:72657593..72657613 58.93 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTCAGATGGCTCGTGACT Chr9:72657603..72657623 58.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036030