Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17262
Trapped Gene
Ankrd35 (ENSMUSG00000038354)
Vector Insertion
Chr 3: 96482187 - 96483102
Public Clones IST14227F2 (tigm) IST10618E4 (tigm) IST11559D7 (tigm) IST14418C2 (tigm)
Private Clones OST446485 (lexicon) OST256024 (lexicon) OST118607 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370295 (Chr3:96482056..96482186 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAATGGAACCGACGTGAT Chr3:96482060..96482079 59.41 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370295 (Chr3:96482056..96482186 +)
Downstram Exon
ENSMUSE00000397790 (Chr3:96483103..96483191 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAATGGAACCGACGTGAT Chr3:96482060..96482079 59.41 45 CCCCATTTGCAAGCAGTATT Chr3:96483167..96483186 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410288 Chr3:96474054..96474372 TAGCCGAGTTGGGTTAGGAA Chr3:96474260..96474279 59.7 50
upstream ENSMUSE00000370295 Chr3:96482056..96482186 AGAAATGGAACCGACGTGAT Chr3:96482060..96482079 59.41 45

*** Putative Vector Insertion (Chr 3: 96482187 - 96483102) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000397790 Chr3:96483103..96483191 CCCCATTTGCAAGCAGTATT Chr3:96483167..96483186 59.96 45
downstream ENSMUSE00000357628 Chr3:96483553..96483617 ACACACTGTGGCTGACAGGA Chr3:96483604..96483623 60.37 55
downstream ENSMUSE00000346384 Chr3:96484394..96484451 AATGGACTGCGATTTTCTGC Chr3:96484443..96484462 60.22 45
downstream ENSMUSE00000384381 Chr3:96484550..96484620 CACAGCAGGAGGACACTTGA Chr3:96484589..96484608 60.02 55
downstream ENSMUSE00000334317 Chr3:96484885..96484991 CATTAACTCGGGCACCTCTC Chr3:96484975..96484994 59.69 55
downstream ENSMUSE00000369013 Chr3:96485950..96486134 AAGAGCGTTGTGTCCCAAAC Chr3:96486061..96486080 60.16 50
downstream ENSMUSE00000362130 Chr3:96486917..96486954 GAGATGGGTGATCTGGGTGT Chr3:96486955..96486974 59.77 55
downstream ENSMUSE00000354995 Chr3:96487106..96489097 CCGATGAGGTGGTTTGTCTT Chr3:96489075..96489094 59.97 50
downstream ENSMUSE00000248243 Chr3:96493069..96493158 GCTCGAGCTTCTTCAGCAAC Chr3:96493099..96493118 60.43 55
downstream ENSMUSE00000248237 Chr3:96493368..96493433 TTCGTGGTTCTTCTGGGAGT Chr3:96493391..96493410 59.7 50
downstream ENSMUSE00000438379 Chr3:96494115..96494957 TCAGGTCTGGAGTTCGTGTG Chr3:96494872..96494891 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATAATCGCCTTGCAGCAC Chr3:96482235..96482255 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGAACGTGACTGGGAAAA Chr3:96482232..96482252 59.26 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038354