Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17266
Trapped Gene
Kcng3 (ENSMUSG00000045053)
Vector Insertion
Chr 17: 83987720 - 84030302
Public Clones not available
Private Clones OST446377 (lexicon) OST444129 (lexicon) OST371309 (lexicon) OST220291 (lexicon)
OST66687 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370027 (Chr17:84030303..84031235 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGTGTTCGTGATCGTGTC Chr17:84030417..84030436 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370027 (Chr17:84030303..84031235 -)
Downstram Exon
ENSMUSE00000402818 (Chr17:83985297..83987719 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGTGTTCGTGATCGTGTC Chr17:84030417..84030436 60.01 55 TCTGAGTCACGGCAACTGAC Chr17:83986278..83986297 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000370027 Chr17:84030303..84031235 GTGGTGTTCGTGATCGTGTC Chr17:84030417..84030436 60.01 55

*** Putative Vector Insertion (Chr 17: 83987720 - 84030302) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000402818 Chr17:83985297..83987719 TCTGAGTCACGGCAACTGAC Chr17:83986278..83986297 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGGGAAGTAATCGCCTTG Chr17:83991240..83991260 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCTGCATTTTTCCGTGAC Chr17:83991245..83991265 61.04 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045053