Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17270
Trapped Gene
Ubac2 (ENSMUSG00000041765)
Vector Insertion
Chr 14: 122304473 - 122306512
Public Clones not available
Private Clones OST446163 (lexicon) OST434551 (lexicon) OST405941 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000433942 (Chr14:122304345..122304472 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGCTGTCAAGCACGACTT Chr14:122304449..122304468 60.06 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000433942 (Chr14:122304345..122304472 +)
Downstram Exon
ENSMUSE00000433902 (Chr14:122306513..122306632 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGCTGTCAAGCACGACTT Chr14:122304449..122304468 60.06 50 GCGAACTTCCTGCTTCCATA Chr14:122306634..122306653 60.35 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000482899 Chr14:122277828..122277996 No primer for this exon
upstream ENSMUSE00000433942 Chr14:122304345..122304472 CATGCTGTCAAGCACGACTT Chr14:122304449..122304468 60.06 50

*** Putative Vector Insertion (Chr 14: 122304473 - 122306512) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000433902 Chr14:122306513..122306632 GCGAACTTCCTGCTTCCATA Chr14:122306634..122306653 60.35 50
downstream ENSMUSE00000433896 Chr14:122307433..122307542 TGACACCAAGCGAATACTGC Chr14:122307517..122307536 59.87 50
downstream ENSMUSE00000433888 Chr14:122372831..122372954 TGGAACAAAGAGAGCGAACA Chr14:122372864..122372883 59.57 45
downstream ENSMUSE00000433877 Chr14:122382490..122382537 CCAGATGTAGGACCCAGAGG Chr14:122382519..122382538 59.53 60
downstream ENSMUSE00000356071 Chr14:122393447..122393692 AGGAGAAGAACTCGGCCATT Chr14:122393534..122393553 60.21 50
downstream ENSMUSE00000226438 Chr14:122408013..122408135 CGGTTCCAATTGATCATTCC Chr14:122408038..122408057 60.13 45
downstream ENSMUSE00000433856 Chr14:122419172..122420256 CGGGCACATCACTGTCATAC Chr14:122419314..122419333 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCGTGTATGACCTCCATGC Chr14:122304435..122304455 59.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCGTGTATGACCTCCATGC Chr14:122304435..122304455 59.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041765