Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17288
Trapped Gene
Prkci (ENSMUSG00000037643)
Vector Insertion
Chr 3: 30924142 - 30925174
Public Clones CMHD-GT_437C3-3 (cmhd) CMHD-GT_408B4-3 (cmhd)
Private Clones OST445898 (lexicon) OST297394 (lexicon) OST244083 (lexicon) OST198292 (lexicon)
OST38026 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273487 (Chr3:30924052..30924141 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGTACGAGCTGAACAAGG Chr3:30924101..30924120 58.68 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273487 (Chr3:30924052..30924141 +)
Downstram Exon
ENSMUSE00000273474 (Chr3:30925175..30925225 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGTACGAGCTGAACAAGG Chr3:30924101..30924120 58.68 55 GACGCTCTGGTACACATGGA Chr3:30925201..30925220 59.71 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445045 Chr3:30894669..30895007 GTCCGGGTGAAAGCCTACTAC Chr3:30894982..30895002 60.01 57.14
upstream ENSMUSE00000273499 Chr3:30917472..30917593 CCGTTCACCATGAAATGGAT Chr3:30917563..30917582 60.58 45
upstream ENSMUSE00000273487 Chr3:30924052..30924141 GCTGTACGAGCTGAACAAGG Chr3:30924101..30924120 58.68 55

*** Putative Vector Insertion (Chr 3: 30924142 - 30925174) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000273474 Chr3:30925175..30925225 GACGCTCTGGTACACATGGA Chr3:30925201..30925220 59.71 55
downstream ENSMUSE00000273464 Chr3:30928408..30928493 CCCTCTCCGGTAAATGGACT Chr3:30928430..30928449 60.32 55
downstream ENSMUSE00000273454 Chr3:30930006..30930146 CCCACACTCAATTGTGACCA Chr3:30930131..30930150 60.42 50
downstream ENSMUSE00000273444 Chr3:30932100..30932151 No primer for this exon
downstream ENSMUSE00000273437 Chr3:30933421..30933479 TGGTCCAAACTCTCATGACTTG Chr3:30933461..30933482 60.15 45.46
downstream ENSMUSE00000273428 Chr3:30936768..30936944 ACTGGACGACGCTTTACCAC Chr3:30936809..30936828 60.18 55
downstream ENSMUSE00000569053 Chr3:30937372..30937469 CCGACAAGAAAAGGGTGATT Chr3:30937442..30937461 59.03 45
downstream ENSMUSE00000569052 Chr3:30937951..30938037 TGAGGTCCCCTCCATTTACA Chr3:30937994..30938013 60.31 50
downstream ENSMUSE00000273403 Chr3:30938290..30938425 TCCCTCGCTCATGAAGATAA Chr3:30938345..30938364 58.4 45
downstream ENSMUSE00000273399 Chr3:30940364..30940451 GCAGAAAGTGCTGGTTGTGT Chr3:30940405..30940424 58.94 50
downstream ENSMUSE00000273390 Chr3:30942613..30942738 GCTCCCAACGATATCAAACG Chr3:30942698..30942717 60.47 50
downstream ENSMUSE00000273384 Chr3:30943804..30943883 No primer for this exon
downstream ENSMUSE00000273378 Chr3:30945395..30945484 ACAACCCAATCGTTCCTTTG Chr3:30945421..30945440 59.83 45
downstream ENSMUSE00000273376 Chr3:30945894..30946009 GGAGTGAGCTGGACTGGTTC Chr3:30946003..30946022 59.84 60
downstream ENSMUSE00000444307 Chr3:30949112..30951659 TAGCAGCTTAGGGCGTGAAT Chr3:30950855..30950874 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000037643