Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17292
Trapped Gene
Cnn3 (ENSMUSG00000053931)
Vector Insertion
Chr 3: 121152989 - 121153209
Public Clones not available
Private Clones OST445798 (lexicon) OST419273 (lexicon) OST242387 (lexicon) OST221948 (lexicon)
OST213524 (lexicon) OST131288 (lexicon) OST78861 (lexicon) OST32716 (lexicon)
OST8147 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636208 (Chr3:121152867..121152988 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTAGGCATTGGCACCAACTT Chr3:121152933..121152952 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636208 (Chr3:121152867..121152988 +)
Downstram Exon
ENSMUSE00000636205 (Chr3:121153210..121153276 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTAGGCATTGGCACCAACTT Chr3:121152933..121152952 60.13 50 GGGGCCAATTTAGTGAGGAT Chr3:121153277..121153296 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359223 Chr3:121129452..121129746 AGGGTGACTGACCGCTAGAA Chr3:121129647..121129666 59.87 55
upstream ENSMUSE00000636208 Chr3:121152867..121152988 CTAGGCATTGGCACCAACTT Chr3:121152933..121152952 60.13 50

*** Putative Vector Insertion (Chr 3: 121152989 - 121153209) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636205 Chr3:121153210..121153276 GGGGCCAATTTAGTGAGGAT Chr3:121153277..121153296 60.15 50
downstream ENSMUSE00000463156 Chr3:121154301..121154438 CATGGGGCTTCATACCGTAA Chr3:121154361..121154380 60.71 50
downstream ENSMUSE00000465196 Chr3:121154801..121154917 CGCCAATGTCAATGGTTGTA Chr3:121154843..121154862 60.38 45
downstream ENSMUSE00000563954 Chr3:121157865..121158011 CAGGCTAATCGTGGTCTGGT Chr3:121157984..121158003 60.13 55
downstream ENSMUSE00000391013 Chr3:121160000..121160867 GTCTGGGTACTCGCCATGAT Chr3:121160296..121160315 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAGGACGGCATCATATTG Chr3:121152965..121152985 59.5 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAGGACGGCATCATATTG Chr3:121152965..121152985 59.5 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053931