Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17295
Trapped Gene
Kif22 (ENSMUSG00000030677)
Vector Insertion
Chr 7: 134171355 - 134171444
Public Clones CMHD-GT_493E1-3 (cmhd) CMHD-GT_454A2-3 (cmhd)
Private Clones OST445772 (lexicon) OST432650 (lexicon) OST5551 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000201901 (Chr7:134171445..134171504 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGGTGGAAGGCATCTCTG Chr7:134171471..134171490 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000201901 (Chr7:134171445..134171504 -)
Downstram Exon
ENSMUSE00000352471 (Chr7:134171246..134171354 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGGTGGAAGGCATCTCTG Chr7:134171471..134171490 60.26 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000201894 Chr7:134185858..134185934 CCGAAGAAGGGAAGGCTATG Chr7:134185913..134185932 61.07 55
upstream ENSMUSE00000201906 Chr7:134179262..134179454 CTGTGTCCGAGCCATAGACA Chr7:134179317..134179336 59.85 55
upstream ENSMUSE00000201900 Chr7:134177638..134177765 TATGGCGAGAAGAGCACTCA Chr7:134177733..134177752 59.7 50
upstream ENSMUSE00000201897 Chr7:134177392..134177546 GGACCTCCTGCAACTAGCAA Chr7:134177466..134177485 60.4 55
upstream ENSMUSE00000201896 Chr7:134176983..134177192 GACTTCGAGCAGCACTTCCT Chr7:134177065..134177084 59.75 55
upstream ENSMUSE00000201902 Chr7:134176676..134176906 ATACCATACCGGGACAGCAA Chr7:134176695..134176714 60.21 50
upstream ENSMUSE00000201905 Chr7:134176396..134176549 AGGTGATTAACCGGCCTTTC Chr7:134176421..134176440 60.32 50
upstream ENSMUSE00000669477 Chr7:134176148..134176278 CCTTGGCACCTGTTAAGCTG Chr7:134176259..134176278 60.82 55
upstream ENSMUSE00000201895 Chr7:134176143..134176278 CCTTGGCACCTGTTAAGCTG Chr7:134176259..134176278 60.82 55
upstream ENSMUSE00000201893 Chr7:134174443..134174611 TGAATACCCCAAAGCGAGAA Chr7:134174491..134174510 60.58 45
upstream ENSMUSE00000669476 Chr7:134174443..134174616 TGAATACCCCAAAGCGAGAA Chr7:134174491..134174510 60.58 45
upstream ENSMUSE00000201903 Chr7:134172849..134173014 AGCCGCCTGCCTCTTATAGT Chr7:134172901..134172920 60.38 55
upstream ENSMUSE00000201899 Chr7:134172429..134172490 AGCAGCGAGAGTCCTCAAAC Chr7:134172465..134172484 59.75 55
upstream ENSMUSE00000201904 Chr7:134171584..134171796 GCCCAGAGTTACTGGCACAT Chr7:134171713..134171732 60.14 55
upstream ENSMUSE00000201901 Chr7:134171445..134171504 ACAGGTGGAAGGCATCTCTG Chr7:134171471..134171490 60.26 55

*** Putative Vector Insertion (Chr 7: 134171355 - 134171444) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000352471 Chr7:134171246..134171354 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000030677