Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17299
Trapped Gene
Dnm2 (ENSMUSG00000033335)
Vector Insertion
Chr 9: 21262021 - 21270025
Public Clones (sanger) (cmhd) IST14791A6 (tigm) IST11858H2 (tigm) IST14599B5 (tigm)
IST14351B12 (tigm) IST14418G9 (tigm) IST14407C10 (tigm) IST11858H2 (tigm)
IST14791A6 (tigm) IST10608E3 (tigm)
Private Clones OST445741 (lexicon) OST429885 (lexicon) OST352614 (lexicon) OST298124 (lexicon)
OST282077 (lexicon) OST100946 (lexicon) OST50825 (lexicon) OST32657 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000584899 (Chr9:21261947..21262020 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCTTCCACGAGGATCAG Chr9:21261950..21261969 59.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000584899 (Chr9:21261947..21262020 +)
Downstram Exon
ENSMUSE00000584898 (Chr9:21270026..21270175 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCTTCCACGAGGATCAG Chr9:21261950..21261969 59.8 55 CAGTGCAAAAATTCCGCATA Chr9:21270050..21270069 59.7 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000476895 Chr9:21229415..21229700 ACATCGGAACCGAGAGTCTT Chr9:21229487..21229506 58.74 50
upstream ENSMUSE00000584899 Chr9:21261947..21262020 CTTCCTTCCACGAGGATCAG Chr9:21261950..21261969 59.8 55

*** Putative Vector Insertion (Chr 9: 21262021 - 21270025) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000584898 Chr9:21270026..21270175 CAGTGCAAAAATTCCGCATA Chr9:21270050..21270069 59.7 40
downstream ENSMUSE00000584897 Chr9:21271976..21272179 GGTCGATGAGGGTCAAGTTC Chr9:21272002..21272021 59.51 55
downstream ENSMUSE00000584896 Chr9:21275787..21275885 ATGACACCGATGGTCCGTAG Chr9:21275811..21275830 60.8 55
downstream ENSMUSE00000584895 Chr9:21277057..21277217 TTTTTGCCCTCGATGTCTTT Chr9:21277108..21277127 59.69 40
downstream ENSMUSE00000638336 Chr9:21278976..21279118 TCAGGCCGGAAATTCTTGTA Chr9:21279088..21279107 60.58 45
downstream ENSMUSE00000584893 Chr9:21280917..21281052 AGCCTTCAATTCGCTTCTCA Chr9:21280966..21280985 60.1 45
downstream ENSMUSE00000638335 Chr9:21282725..21282787 No primer for this exon
downstream ENSMUSE00000702744 Chr9:21282725..21282792 No primer for this exon
downstream ENSMUSE00000638334 Chr9:21283038..21283042 No primer for this exon
downstream ENSMUSE00000584892 Chr9:21283343..21283481 CAGGGCTCTTTCAGCTTGAC Chr9:21283420..21283439 60.13 55
downstream ENSMUSE00000638333 Chr9:21284851..21284989 GACACCACCAGGTCAACACA Chr9:21284955..21284974 60.48 55
downstream ENSMUSE00000584891 Chr9:21285777..21285863 CCTTCTCGCTCCCTGATGTA Chr9:21285850..21285869 60.35 55
downstream ENSMUSE00000584890 Chr9:21290095..21290165 TTGGCAAATCCAATGAAGTC Chr9:21290168..21290187 58.55 40
downstream ENSMUSE00000584889 Chr9:21294187..21294238 GGGTATGGCCCTCTTCTTGT Chr9:21294235..21294254 60.33 55
downstream ENSMUSE00000702763 Chr9:21295102..21295113 No primer for this exon
downstream ENSMUSE00000638331 Chr9:21298948..21299061 GCTGTCAGCACGAACCAGTA Chr9:21299033..21299052 60.06 55
downstream ENSMUSE00000638330 Chr9:21303702..21303811 AAACACGTGCTTGTTGGACA Chr9:21303791..21303810 60.2 45
downstream ENSMUSE00000584885 Chr9:21304702..21304813 CTGGGAGTCACAAGCCAGTT Chr9:21304753..21304772 60.3 55
downstream ENSMUSE00000638329 Chr9:21307986..21308150 CACGGATGGACTTGTTGATG Chr9:21308112..21308131 59.96 50
downstream ENSMUSE00000584881 Chr9:21308874..21309106 CTCCTTCAGTGCGTGGTACA Chr9:21309011..21309030 59.9 55
downstream ENSMUSE00000584860 Chr9:21309908..21310159 GTGCACACTGGACACAGGTC Chr9:21309947..21309966 60.22 60
downstream ENSMUSE00000584869 Chr9:21310777..21311568 TCATACAGCCCAAACCACAA Chr9:21311419..21311438 59.96 45
downstream ENSMUSE00000584874 Chr9:21310780..21310846 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTGGGAGCTTCTTGTTCA Chr9:21267992..21268012 60.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTGGGAGCTTCTTGTTCA Chr9:21267992..21268012 60.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033335