Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17324
Trapped Gene
Ltbp4 (ENSMUSG00000040488)
Vector Insertion
Chr 7: 28094434 - 28095199
Public Clones (sanger) (sanger) IST12505C1 (tigm) IST13952B10 (tigm) IST10552H3 (tigm)
IST13191G4 (tigm) IST14305B8 (tigm) IST14337A7 (tigm) IST10873E10HMF2 (tigm)
IST10480G11 (tigm) IST14549D8 (tigm) IST12430C5 (tigm) IST13657G2 (tigm)
IST10394A11HMF1 (tigm) IST11258A6 (tigm)
Private Clones OST445176 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000535647 (Chr7:28095200..28095271 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCAGTCATTGTGTCCTCACG Chr7:28095245..28095265 61.03 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000535647 (Chr7:28095200..28095271 -)
Downstram Exon
ENSMUSE00000535645 (Chr7:28094305..28094433 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCAGTCATTGTGTCCTCACG Chr7:28095245..28095265 61.03 52.38 AAGAGTTGGCATTCGTCCAC Chr7:28094390..28094409 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000501397 Chr7:28122447..28122711 AGAAAGTGAGTCGGCCTCTG Chr7:28122681..28122700 59.6 55
upstream ENSMUSE00000676489 Chr7:28120696..28120730 TGTCACTGCTGCCTAGACCA Chr7:28120701..28120720 60.62 55
upstream ENSMUSE00000488113 Chr7:28120672..28120730 GCTGCCTAGACCAGACACCT Chr7:28120694..28120713 59.48 60
upstream ENSMUSE00000490043 Chr7:28120416..28120554 CAGTCCCGTGGAGAAGAGTC Chr7:28120444..28120463 59.83 60
upstream ENSMUSE00000484703 Chr7:28119856..28119965 GAAAAGAAGGCCCCCACATC Chr7:28119880..28119899 62.97 55
upstream ENSMUSE00000676487 Chr7:28118431..28118648 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000676486 Chr7:28118374..28118428 No primer for this exon
upstream ENSMUSE00000708828 Chr7:28118374..28118667 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000709573 Chr7:28118374..28118632 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000716944 Chr7:28118374..28118682 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000307052 Chr7:28115146..28115337 TCCCTTGATCTGTCACAACG Chr7:28115311..28115330 59.68 50
upstream ENSMUSE00000535658 Chr7:28114590..28114837 TTTAGAGAACTGCGCGGAAG Chr7:28114594..28114613 60.65 50
upstream ENSMUSE00000535657 Chr7:28114398..28114500 CCTGGGGTGTTCATGATTGT Chr7:28114420..28114439 60.63 50
upstream ENSMUSE00000535656 Chr7:28113987..28114061 ACCCGGCTTCGAGAGAGTTA Chr7:28114002..28114021 61.28 55
upstream ENSMUSE00000535654 Chr7:28113759..28113881 GTGTATGTCCGGACGGTTTC Chr7:28113790..28113809 60.24 55
upstream ENSMUSE00000535653 Chr7:28113205..28113369 GCCAGCTCTGTCCACCTTAT Chr7:28113212..28113231 59.31 55
upstream ENSMUSE00000407351 Chr7:28112657..28112806 TGACCTCCGATACAACACCA Chr7:28112735..28112754 59.96 50
upstream ENSMUSE00000362610 Chr7:28112280..28112531 TTCTGCCTACTCGTCGACCT Chr7:28112509..28112528 60.01 55
upstream ENSMUSE00000307165 Chr7:28111711..28111842 CAGCATGTGTCAGCGAAATC Chr7:28111813..28111832 60.42 50
upstream ENSMUSE00000307108 Chr7:28111506..28111631 AATACACCAGGCAGCTTTCG Chr7:28111559..28111578 60.27 50
upstream ENSMUSE00000307161 Chr7:28110697..28110822 GCCAGGCAGTTTCCTATGTG Chr7:28110745..28110764 60.66 55
upstream ENSMUSE00000307156 Chr7:28110038..28110280 GCGTGTGAAGAAGATGTGGA Chr7:28110157..28110176 59.84 50
upstream ENSMUSE00000307950 Chr7:28109313..28109438 TTCAAGTGTGTCTGCCCAAC Chr7:28109351..28109370 59.73 50
upstream ENSMUSE00000308043 Chr7:28109106..28109225 GGGCAGGAGTGTGTGAACTC Chr7:28109171..28109190 60.72 60
upstream ENSMUSE00000308034 Chr7:28108161..28108289 CATGGCCAGTGCACAAATAC Chr7:28108232..28108251 59.99 50
upstream ENSMUSE00000308025 Chr7:28107830..28107955 ACCTCGTGGAGCATCTTGTC Chr7:28107833..28107852 60.27 55
upstream ENSMUSE00000308018 Chr7:28107308..28107430 AGAGCGGCATCTGTACCAAC Chr7:28107378..28107397 60.28 55
upstream ENSMUSE00000308012 Chr7:28107041..28107172 ACTGCGATCCAGGTTACCAC Chr7:28107066..28107085 60 55
upstream ENSMUSE00000307031 Chr7:28104644..28104775 AATACGGCTCTGCGATTTGT Chr7:28104738..28104757 59.74 45
upstream ENSMUSE00000307152 Chr7:28104430..28104555 CTTTCAGTGCGTCTGTGACC Chr7:28104469..28104488 59.47 55
upstream ENSMUSE00000535649 Chr7:28099256..28099402 CATGACTGGACGCTGTGTTC Chr7:28099274..28099293 60.32 55
upstream ENSMUSE00000711483 Chr7:28096579..28096831 GACCGGTTTCAATCCAGAAA Chr7:28096779..28096798 59.91 45
upstream ENSMUSE00000535648 Chr7:28095540..28095806 GACAATATCTTGGCCCGAAA Chr7:28095626..28095645 59.9 45
upstream ENSMUSE00000535647 Chr7:28095200..28095271 ACCAGTCATTGTGTCCTCACG Chr7:28095245..28095265 61.03 52.38

*** Putative Vector Insertion (Chr 7: 28094434 - 28095199) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000535645 Chr7:28094305..28094433 AAGAGTTGGCATTCGTCCAC Chr7:28094390..28094409 60.12 50
downstream ENSMUSE00000535644 Chr7:28093940..28094086 GCTCGCAGGTACAGTGGTAAG Chr7:28093978..28093998 59.95 57.14
downstream ENSMUSE00000307972 Chr7:28092787..28092939 AGACAGCAGCACTCGGTGTA Chr7:28092818..28092837 59.65 55
downstream ENSMUSE00000307021 Chr7:28091581..28091961 AGGGGTCGTAGGGTAGCACT Chr7:28091772..28091791 60.02 60
downstream ENSMUSE00000307074 Chr7:28091086..28091238 TACCACACTCTTCGGCCTCT Chr7:28091169..28091188 59.87 55
downstream ENSMUSE00000719934 Chr7:28091017..28091238 TACCACACTCTTCGGCCTCT Chr7:28091169..28091188 59.87 55
downstream ENSMUSE00000465029 Chr7:28090161..28090569 GCAAATCCTGGACGACAGAT Chr7:28090442..28090461 60.08 50
downstream ENSMUSE00000709638 Chr7:28090159..28090569 GCAAATCCTGGACGACAGAT Chr7:28090442..28090461 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGACTTCAACCCCACCTA Chr7:28095172..28095192 59.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCTCTCGTGACTGGGAAA Chr7:28095135..28095155 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TACCTGGTGCCCAGTAATCG Chr7:28095215..28095235 60.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAGTCATTGTGTCCTCACG Chr7:28095243..28095263 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040488