Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1733
Trapped Gene
Arrdc3 (ENSMUSG00000074794)
Vector Insertion
Chr 13: 81023191 - 81026666
Public Clones CG0361 (sanger) CSE536 (baygenomics) CSE537 (baygenomics) IST14949G5 (tigm)
IST11406G2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641035 (Chr13:81022671..81023190 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATCCTGCCTGCATGATTTT Chr13:81022778..81022797 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641035 (Chr13:81022671..81023190 +)
Downstram Exon
ENSMUSE00000641034 (Chr13:81026667..81026748 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATCCTGCCTGCATGATTTT Chr13:81022778..81022797 60.04 45 GGAAGCTCGAAGCTAAATGC Chr13:81026745..81026764 59.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641035 Chr13:81022671..81023190 GATCCTGCCTGCATGATTTT Chr13:81022778..81022797 60.04 45

*** Putative Vector Insertion (Chr 13: 81023191 - 81026666) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641034 Chr13:81026667..81026748 GGAAGCTCGAAGCTAAATGC Chr13:81026745..81026764 59.21 50
downstream ENSMUSE00000641033 Chr13:81028350..81028497 GCCTTCGAATGAGGTAGCAA Chr13:81028377..81028396 60.35 50
downstream ENSMUSE00000641029 Chr13:81029357..81029459 GGTGTAGCCCTTCCTTTCAA Chr13:81029458..81029477 59.17 50
downstream ENSMUSE00000641028 Chr13:81029795..81030051 GCACTACCATTCGGGAAGAG Chr13:81029854..81029873 59.69 55
downstream ENSMUSE00000641027 Chr13:81030323..81030485 GCTCACACTTGAGGTTCTGCT Chr13:81030429..81030449 59.66 52.38
downstream ENSMUSE00000641025 Chr13:81030749..81030903 AGGAACCGAAACTCCTGGAT Chr13:81030884..81030903 59.94 50
downstream ENSMUSE00000641024 Chr13:81032631..81035290 ATGGTAGTGAGTGCCCAAGG Chr13:81034865..81034884 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATTGGGCACGAAAGAGG Chr13:81023173..81023193 60.07 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGCACGAAAGAGGTAAGT Chr13:81023178..81023198 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074794