Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17340
Trapped Gene
Tmem209 (ENSMUSG00000029782)
Vector Insertion
Chr 6: 30447994 - 30451900
Public Clones not available
Private Clones OST444616 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000192778 (Chr6:30451901..30452102 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCCACGGTCTACAACTCA Chr6:30451992..30452011 59.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000192778 (Chr6:30451901..30452102 -)
Downstram Exon
ENSMUSE00000192771 (Chr6:30447818..30447993 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCCACGGTCTACAACTCA Chr6:30451992..30452011 59.59 55 AGGGCTGGTAGAAGGAGAGG Chr6:30447937..30447956 59.83 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000660953 Chr6:30459685..30459715 GGCTTCCTGCTGAAGAACAT Chr6:30459686..30459705 59.43 50
upstream ENSMUSE00000701864 Chr6:30459685..30459718 GGCTTCCTGCTGAAGAACAT Chr6:30459686..30459705 59.43 50
upstream ENSMUSE00000711479 Chr6:30459685..30459719 GGCTTCCTGCTGAAGAACAT Chr6:30459686..30459705 59.43 50
upstream ENSMUSE00000713276 Chr6:30459685..30459719 GGCTTCCTGCTGAAGAACAT Chr6:30459686..30459705 59.43 50
upstream ENSMUSE00000655962 Chr6:30458666..30458802 AAGGAGACGTAAGCCCCAAT Chr6:30458779..30458798 59.96 50
upstream ENSMUSE00000701863 Chr6:30458666..30458842 AAGGAGACGTAAGCCCCAAT Chr6:30458779..30458798 59.96 50
upstream ENSMUSE00000701884 Chr6:30458666..30458802 AAGGAGACGTAAGCCCCAAT Chr6:30458779..30458798 59.96 50
upstream ENSMUSE00000192772 Chr6:30458454..30458512 TGTGACATACTGGCCCCTCT Chr6:30458463..30458482 60.53 55
upstream ENSMUSE00000192776 Chr6:30456786..30456917 CCGTAGCACCAACAAGTCTG Chr6:30456832..30456851 59.36 55
upstream ENSMUSE00000192764 Chr6:30455733..30455974 CCCTTCGATTCAAGGTCAAA Chr6:30455894..30455913 60.04 45
upstream ENSMUSE00000192778 Chr6:30451901..30452102 CACCCACGGTCTACAACTCA Chr6:30451992..30452011 59.59 55

*** Putative Vector Insertion (Chr 6: 30447994 - 30451900) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000192771 Chr6:30447818..30447993 AGGGCTGGTAGAAGGAGAGG Chr6:30447937..30447956 59.83 60
downstream ENSMUSE00000192779 Chr6:30447167..30447238 TCCATGTGATCGAGAAGCTG Chr6:30447170..30447189 59.94 50
downstream ENSMUSE00000192762 Chr6:30444738..30444834 GTAGCTCTGGACAGCCCATC Chr6:30444725..30444744 59.83 60
downstream ENSMUSE00000192765 Chr6:30442597..30442722 No primer for this exon
downstream ENSMUSE00000192775 Chr6:30441087..30441184 CTGTATCCCATTTGCGTCCT Chr6:30441085..30441104 59.96 50
downstream ENSMUSE00000192769 Chr6:30439476..30439590 CGTCTGAACGAAGTGCTGAG Chr6:30439467..30439486 59.77 55
downstream ENSMUSE00000192780 Chr6:30439293..30439390 GATTGTAGACATGCCGCTGA Chr6:30439279..30439298 59.83 50
downstream ENSMUSE00000396564 Chr6:30437375..30437448 CAAGCATTCCTGACTCTTTGG Chr6:30437354..30437374 59.86 47.62
downstream ENSMUSE00000405062 Chr6:30432961..30432985 No primer for this exon
downstream ENSMUSE00000660952 Chr6:30432801..30432985 CAAAATGTTCACGCCAGAGA Chr6:30432927..30432946 59.84 45
downstream ENSMUSE00000563976 Chr6:30432749..30432958 AGAAGGTGCAGGCTTTGCTA Chr6:30432729..30432748 60.15 50
downstream ENSMUSE00000701877 Chr6:30432419..30432985 ACAGGATGAGGTGCAGGTTC Chr6:30432609..30432628 60.12 55
downstream ENSMUSE00000701862 Chr6:30432415..30432985 ACAGGATGAGGTGCAGGTTC Chr6:30432609..30432628 60.12 55
downstream ENSMUSE00000660951 Chr6:30430797..30431137 GGAACACGTGACACACATCC Chr6:30430980..30430999 59.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATAATCGCCTTGCAGCACA Chr6:30451831..30451851 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTTAAACGTGACTGGGAAA Chr6:30448836..30448856 58.67 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029782