Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17355
Trapped Gene
Prcc (ENSMUSG00000004895)
Vector Insertion
Chr 3: 87663269 - 87664067
Public Clones CMHD-GT_469D5-3 (cmhd) PST22954-NR (escells)
Private Clones OST444067 (lexicon) OST398386 (lexicon) OST344195 (lexicon) OST248019 (lexicon)
OST177074 (lexicon) OST59229 (lexicon) OST50077 (lexicon) OST42512 (lexicon)
OST7726 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000356432 (Chr3:87664068..87664133 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000356432 (Chr3:87664068..87664133 -)
Downstram Exon
ENSMUSE00000465061 (Chr3:87662839..87663268 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000175818 Chr3:87688797..87689503 No primer for this exon
upstream ENSMUSE00000175822 Chr3:87676132..87676179 No primer for this exon
upstream ENSMUSE00000175819 Chr3:87673505..87674071 No primer for this exon
upstream ENSMUSE00000295372 Chr3:87671237..87671332 No primer for this exon
upstream ENSMUSE00000295360 Chr3:87666053..87666196 No primer for this exon
upstream ENSMUSE00000356432 Chr3:87664068..87664133 No primer for this exon

*** Putative Vector Insertion (Chr 3: 87663269 - 87664067) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465061 Chr3:87662839..87663268 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGAGGAAACACCAGATCAC Chr3:87664082..87664102 60.51 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGAGGAAACACCAGATCAC Chr3:87664082..87664102 60.51 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCAGATCATAATCGCCTTGC Chr3:87664071..87664091 60.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAGGAAACACCAGATCACG Chr3:87664081..87664101 60.51 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004895