Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17376
Trapped Gene
Bsn (ENSMUSG00000032589)
Vector Insertion
Chr 9: 108006050 - 108006274
Public Clones not available
Private Clones OST443762 (lexicon) OST249301 (lexicon) OST154265 (lexicon) OST114404 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000350227 (Chr9:108006275..108006406 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGAACAAGCTGGAAAGC Chr9:108006284..108006303 59.76 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000350227 (Chr9:108006275..108006406 -)
Downstram Exon
ENSMUSE00000221207 (Chr9:108005995..108006049 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGAACAAGCTGGAAAGC Chr9:108006284..108006303 59.76 50 CCTTCTGGACACAATCACCA Chr9:108005973..108005992 59.52 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221208 Chr9:108092375..108092714 No primer for this exon
upstream ENSMUSE00000221217 Chr9:108041518..108041926 ACCTCGGACCTCACATCAAC Chr9:108041609..108041628 59.97 55
upstream ENSMUSE00000245702 Chr9:108028021..108028911 GTCTTCAGTGATGCCAGCAA Chr9:108028364..108028383 59.99 50
upstream ENSMUSE00000221212 Chr9:108019381..108019890 CAGTTGTCAAGCCTGTTCCA Chr9:108019408..108019427 59.87 50
upstream ENSMUSE00000469753 Chr9:108012216..108018857 GCACACAGGGGGTAGTAGGA Chr9:108014982..108015001 59.99 60
upstream ENSMUSE00000245611 Chr9:108008441..108010517 ACTATAGCAGCCGAGGCAAA Chr9:108008763..108008782 60 50
upstream ENSMUSE00000221209 Chr9:108007331..108008139 ATCACGTCAGCCACAGACAC Chr9:108007522..108007541 59.74 55
upstream ENSMUSE00000221214 Chr9:108007117..108007219 No primer for this exon
upstream ENSMUSE00000350227 Chr9:108006275..108006406 AGCAGAACAAGCTGGAAAGC Chr9:108006284..108006303 59.76 50

*** Putative Vector Insertion (Chr 9: 108006050 - 108006274) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221207 Chr9:108005995..108006049 CCTTCTGGACACAATCACCA Chr9:108005973..108005992 59.52 50
downstream ENSMUSE00000221223 Chr9:108005521..108005613 CAGGCCTTTGACTCCAGAGA Chr9:108005527..108005546 60.52 55
downstream ENSMUSE00000245770 Chr9:107998354..108002228 ACTTTAGGGGTCAGGCAGGT Chr9:107999798..107999817 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTGTGGTAATCGCCTTGC Chr9:108006211..108006231 60.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTTCTTTGTGGCGTGACT Chr9:108006216..108006236 59.34 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032589