Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17378
Trapped Gene
RP23-303F24.3 (ENSMUSG00000081769)
Vector Insertion
Chr 11: 53599852 - 53622760
Public Clones IST13084E3 (tigm) IST12942D12 (tigm)
Private Clones OST443751 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716699 (Chr11:53622761..53623295 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACCCCGACAAGAAACAT Chr11:53622990..53623009 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716699 (Chr11:53622761..53623295 -)
Downstram Exon
ENSMUSE00000716885 (Chr11:53598991..53599851 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACCCCGACAAGAAACAT Chr11:53622990..53623009 59.97 50 TTCACAAAGTGGAAGCGATG Chr11:53599789..53599808 59.84 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716999 Chr11:53672615..53672758 CGCTTTCGCTTTTGCTTTTA Chr11:53672734..53672753 60.61 40
upstream ENSMUSE00000711069 Chr11:53663507..53663612 GCTGGACAGCCAAGAAAGAA Chr11:53663555..53663574 60.52 50
upstream ENSMUSE00000721565 Chr11:53627078..53627118 GCCTCCAACGAGAACAGCTA Chr11:53627082..53627101 60.54 55
upstream ENSMUSE00000712387 Chr11:53626463..53626826 CAGCACTTCCATGGGAAAAT Chr11:53626662..53626681 59.93 45
upstream ENSMUSE00000716699 Chr11:53622761..53623295 CTGACCCCGACAAGAAACAT Chr11:53622990..53623009 59.97 50

*** Putative Vector Insertion (Chr 11: 53599852 - 53622760) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000716885 Chr11:53598991..53599851 TTCACAAAGTGGAAGCGATG Chr11:53599789..53599808 59.84 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATGTTGCCGTAGCCAGAAG Chr11:53607718..53607738 58.94 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGAGGCGTTTTCTCACA Chr11:53607729..53607749 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAGGCATCAAAGGCAGAACA Chr11:53608294..53608314 60.78 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACCAACACCATCTGTCGTGA Chr11:53608240..53608260 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000081769