Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17382
Trapped Gene
2010111I01Rik (ENSMUSG00000021458)
Vector Insertion
Chr 13: 63398253 - 63400019
Public Clones D116E11 (ggtc) D116E11 (ggtc)
Private Clones OST443691 (lexicon) OST302713 (lexicon) OST194584 (lexicon) OST184859 (lexicon)
OST68678 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000383929 (Chr13:63398166..63398252 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000383929 (Chr13:63398166..63398252 +)
Downstram Exon
ENSMUSE00000641517 (Chr13:63400020..63400164 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681617 Chr13:63116294..63117323 No primer for this exon
upstream ENSMUSE00000323812 Chr13:63116527..63117323 No primer for this exon
upstream ENSMUSE00000323804 Chr13:63134383..63134549 No primer for this exon
upstream ENSMUSE00000323793 Chr13:63162395..63162554 No primer for this exon
upstream ENSMUSE00000614335 Chr13:63169400..63169645 No primer for this exon
upstream ENSMUSE00000614334 Chr13:63257906..63258095 No primer for this exon
upstream ENSMUSE00000614333 Chr13:63272301..63272407 No primer for this exon
upstream ENSMUSE00000614332 Chr13:63291788..63291890 No primer for this exon
upstream ENSMUSE00000614331 Chr13:63292375..63292482 No primer for this exon
upstream ENSMUSE00000614330 Chr13:63300816..63300859 No primer for this exon
upstream ENSMUSE00000614329 Chr13:63311415..63311475 No primer for this exon
upstream ENSMUSE00000614328 Chr13:63341396..63341464 No primer for this exon
upstream ENSMUSE00000410517 Chr13:63341566..63341640 No primer for this exon
upstream ENSMUSE00000338658 Chr13:63383450..63383566 No primer for this exon
upstream ENSMUSE00000383929 Chr13:63398166..63398252 No primer for this exon

*** Putative Vector Insertion (Chr 13: 63398253 - 63400019) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641517 Chr13:63400020..63400164 No primer for this exon
downstream ENSMUSE00000681602 Chr13:63400020..63400964 No primer for this exon
downstream ENSMUSE00000570645 Chr13:63403087..63403592 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTACTGGAGGACCAGGTGA Chr13:63398238..63398258 60.1 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACTGGAGGACCAGGTGA Chr13:63398238..63398258 60.1 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021458