Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17386
Trapped Gene
Rc3h2 (ENSMUSG00000075376)
Vector Insertion
Chr 2: 37270335 - 37274951
Public Clones not available
Private Clones OST443660 (lexicon) OST353034 (lexicon) OST275641 (lexicon) OST196087 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693687 (Chr2:37274952..37274987 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693687 (Chr2:37274952..37274987 -)
Downstram Exon
ENSMUSE00000645611 (Chr2:37270036..37270334 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAAGCTGATGCTCGGGTTAG Chr2:37270249..37270268 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693688 Chr2:37278287..37278423 GTAGCTCCCGATGGAGTTTG Chr2:37278404..37278423 59.69 55
upstream ENSMUSE00000693696 Chr2:37278287..37278389 No primer for this exon
upstream ENSMUSE00000693687 Chr2:37274952..37274987 No primer for this exon

*** Putative Vector Insertion (Chr 2: 37270335 - 37274951) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645611 Chr2:37270036..37270334 GAAGCTGATGCTCGGGTTAG Chr2:37270249..37270268 59.98 55
downstream ENSMUSE00000693695 Chr2:37270036..37270332 GAAGCTGATGCTCGGGTTAG Chr2:37270249..37270268 59.98 55
downstream ENSMUSE00000645610 Chr2:37266660..37266777 GCCAAGTCCTCTACGCATTT Chr2:37266670..37266689 59.34 50
downstream ENSMUSE00000645609 Chr2:37264954..37265187 TCGCATAGCTCTGACACGAC Chr2:37265056..37265075 60.17 55
downstream ENSMUSE00000645608 Chr2:37260764..37260939 TGCCAGCAATACCAACTTCA Chr2:37260880..37260899 60.26 45
downstream ENSMUSE00000645607 Chr2:37256049..37256249 GCGTAGTGCCTCGTAACTCC Chr2:37256156..37256175 59.9 60
downstream ENSMUSE00000645606 Chr2:37255341..37255473 TTAGCAGGGTCACCAGTTCG Chr2:37255375..37255394 61.22 55
downstream ENSMUSE00000645605 Chr2:37255107..37255225 TGAGGTGTCTCATGGCCTTT Chr2:37255086..37255105 60.66 50
downstream ENSMUSE00000645604 Chr2:37253764..37253876 TTGTCGTAAATCTCGGCACA Chr2:37253804..37253823 60.26 45
downstream ENSMUSE00000645603 Chr2:37245105..37245410 ACAGTCGCGCTCATCTTTTT Chr2:37245353..37245372 60.02 45
downstream ENSMUSE00000645602 Chr2:37240766..37240980 ACAGGAGTCTTGGGTGGAGA Chr2:37240929..37240948 59.68 55
downstream ENSMUSE00000645600 Chr2:37238303..37238736 CTCACAAAGCGAGGAACACA Chr2:37238651..37238670 60.03 50
downstream ENSMUSE00000645599 Chr2:37237390..37237557 AGGAGAAGGTGGTGTTGGTG Chr2:37237395..37237414 60 55
downstream ENSMUSE00000645598 Chr2:37234378..37234524 AATTTTGCGCCACTCACACT Chr2:37234474..37234493 60.7 45
downstream ENSMUSE00000645597 Chr2:37233828..37234041 TGGGCTTAGTTGCACTTCCT Chr2:37233818..37233837 59.88 50
downstream ENSMUSE00000645596 Chr2:37233371..37233455 CTCCACCTTGAATCGACAGC Chr2:37233394..37233413 60.8 55
downstream ENSMUSE00000645595 Chr2:37232875..37232956 TGCTCAAAAGGTCTCCGGTA Chr2:37232867..37232886 60.77 50
downstream ENSMUSE00000645594 Chr2:37232654..37232788 ATGGCCAGAGCATTAGCTTC Chr2:37232717..37232736 59.44 50
downstream ENSMUSE00000645593 Chr2:37232409..37232516 TTTGTTCACTCTGGCCATCA Chr2:37232392..37232411 60.24 45
downstream ENSMUSE00000693686 Chr2:37232181..37232310 CTGTCTCTTCGGCTTTCCTG Chr2:37232166..37232185 60.13 55
downstream ENSMUSE00000645592 Chr2:37232162..37232310 CTGTCTCTTCGGCTTTCCTG Chr2:37232166..37232185 60.13 55
downstream ENSMUSE00000645591 Chr2:37230616..37230948 AGGCAGCTTGCACTGCTAAT Chr2:37230846..37230865 60.18 50
downstream ENSMUSE00000693692 Chr2:37228658..37230948 TCCATGCAAAGTCCAATGAA Chr2:37230241..37230260 60.05 40
downstream ENSMUSE00000693684 Chr2:37225589..37230948 AATTGCTTGCCCAGCTAAGA Chr2:37226375..37226394 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr2:37271881..37271901 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTGCTTAGCGTGACTGG Chr2:37271891..37271911 59.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075376