Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17391
Trapped Gene
Cryl1 (ENSMUSG00000021947)
Vector Insertion
Chr 14: 57931967 - 57960888
Public Clones not available
Private Clones OST443585 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000558523 (Chr14:57960889..57961035 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCTCTCTCCGAGTTCTGC Chr14:57960941..57960960 60.43 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000558523 (Chr14:57960889..57961035 -)
Downstram Exon
ENSMUSE00000426676 (Chr14:57931805..57931966 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCTCTCTCCGAGTTCTGC Chr14:57960941..57960960 60.43 60 ATAACCCGGTCATCCACAAT Chr14:57931868..57931887 58.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000558530 Chr14:58017245..58017360 No primer for this exon
upstream ENSMUSE00000308648 Chr14:58001595..58001702 AGATAACAGACGCCCTGGAA Chr14:58001603..58001622 59.69 50
upstream ENSMUSE00000122361 Chr14:57981759..57981885 CCTGGAGCAGTCTGGTTCTC Chr14:57981851..57981870 59.99 60
upstream ENSMUSE00000558523 Chr14:57960889..57961035 CAGCTCTCTCCGAGTTCTGC Chr14:57960941..57960960 60.43 60

*** Putative Vector Insertion (Chr 14: 57931967 - 57960888) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000426676 Chr14:57931805..57931966 ATAACCCGGTCATCCACAAT Chr14:57931868..57931887 58.98 45
downstream ENSMUSE00000426671 Chr14:57922430..57922624 GAAGCCGTCAATCTCCTTCA Chr14:57922462..57922481 60.34 50
downstream ENSMUSE00000426667 Chr14:57905202..57905307 TAGTCTCCAAGGGTCCGATG Chr14:57905198..57905217 60.06 55
downstream ENSMUSE00000426663 Chr14:57894754..57894860 AACAGGCCCGAAAGTACTGA Chr14:57894771..57894790 59.73 50
downstream ENSMUSE00000615387 Chr14:57893872..57894399 GAAATTCACTTGGGCTGCAT Chr14:57894259..57894278 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTAAATGGCTTGTGCTGGT Chr14:57960916..57960936 60.28 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACGTGACTGGGAAAACC Chr14:57960821..57960841 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021947